Incidental Mutation 'R2870:Matr3'
ID253650
Institutional Source Beutler Lab
Gene Symbol Matr3
Ensembl Gene ENSMUSG00000037236
Gene Namematrin 3
Synonyms2810017I02Rik, D030046F20Rik, 1110061A14Rik
MMRRC Submission 040458-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.958) question?
Stock #R2870 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location35562146-35593835 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35572296 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 91 (S91R)
Ref Sequence ENSEMBL: ENSMUSP00000140846 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166793] [ENSMUST00000186292] [ENSMUST00000186614] [ENSMUST00000186796] [ENSMUST00000187389] [ENSMUST00000187513] [ENSMUST00000187543] [ENSMUST00000187793] [ENSMUST00000188275] [ENSMUST00000188359] [ENSMUST00000188767] [ENSMUST00000189039] [ENSMUST00000189163] [ENSMUST00000190029] [ENSMUST00000190121] [ENSMUST00000190458] [ENSMUST00000190653]
Predicted Effect probably benign
Transcript: ENSMUST00000166793
AA Change: S91R

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000125761
Gene: ENSMUSG00000037236
AA Change: S91R

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
ZnF_U1 288 322 4.47e-6 SMART
ZnF_C2H2 291 315 2.12e1 SMART
low complexity region 351 361 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
RRM 399 469 7.74e-3 SMART
RRM 497 567 5.63e-9 SMART
low complexity region 650 675 N/A INTRINSIC
low complexity region 710 718 N/A INTRINSIC
ZnF_U1 797 832 1.87e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186292
SMART Domains Protein: ENSMUSP00000139437
Gene: ENSMUSG00000037236

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186295
Predicted Effect probably benign
Transcript: ENSMUST00000186614
AA Change: S91R

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000141189
Gene: ENSMUSG00000037236
AA Change: S91R

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
ZnF_U1 288 322 2.6e-8 SMART
ZnF_C2H2 291 315 8.8e-2 SMART
low complexity region 351 361 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186796
SMART Domains Protein: ENSMUSP00000140128
Gene: ENSMUSG00000037236

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
low complexity region 33 48 N/A INTRINSIC
RRM 61 131 3.2e-5 SMART
RRM 159 229 2.4e-11 SMART
low complexity region 312 337 N/A INTRINSIC
low complexity region 372 380 N/A INTRINSIC
ZnF_U1 459 494 1.1e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187389
AA Change: S91R

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000139745
Gene: ENSMUSG00000037236
AA Change: S91R

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
ZnF_U1 288 322 4.47e-6 SMART
ZnF_C2H2 291 315 2.12e1 SMART
low complexity region 351 361 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
RRM 399 469 7.74e-3 SMART
RRM 497 567 5.63e-9 SMART
low complexity region 650 675 N/A INTRINSIC
low complexity region 710 718 N/A INTRINSIC
ZnF_U1 797 832 1.87e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187513
SMART Domains Protein: ENSMUSP00000139875
Gene: ENSMUSG00000099703

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187543
Predicted Effect probably benign
Transcript: ENSMUST00000187793
SMART Domains Protein: ENSMUSP00000140047
Gene: ENSMUSG00000099703

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
SCOP:d1lvk_2 42 78 4e-3 SMART
PDB:1X4D|A 52 102 4e-30 PDB
Blast:RRM 61 102 1e-22 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187980
Predicted Effect probably benign
Transcript: ENSMUST00000188275
SMART Domains Protein: ENSMUSP00000140401
Gene: ENSMUSG00000037236

DomainStartEndE-ValueType
low complexity region 63 73 N/A INTRINSIC
low complexity region 83 98 N/A INTRINSIC
RRM 111 181 3.2e-5 SMART
RRM 209 279 2.4e-11 SMART
low complexity region 362 387 N/A INTRINSIC
low complexity region 422 430 N/A INTRINSIC
ZnF_U1 509 544 1.1e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188359
AA Change: S91R

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000140148
Gene: ENSMUSG00000037236
AA Change: S91R

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188767
SMART Domains Protein: ENSMUSP00000141027
Gene: ENSMUSG00000037236

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
low complexity region 33 48 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189039
SMART Domains Protein: ENSMUSP00000139525
Gene: ENSMUSG00000037236

DomainStartEndE-ValueType
ZnF_U1 36 70 2.6e-8 SMART
ZnF_C2H2 39 63 8.8e-2 SMART
low complexity region 99 109 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189163
Predicted Effect probably benign
Transcript: ENSMUST00000190029
AA Change: S91R

PolyPhen 2 Score 0.246 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000140846
Gene: ENSMUSG00000037236
AA Change: S91R

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
low complexity region 52 65 N/A INTRINSIC
low complexity region 69 85 N/A INTRINSIC
ZnF_U1 288 322 4.47e-6 SMART
ZnF_C2H2 291 315 2.12e1 SMART
low complexity region 351 361 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
RRM 399 469 7.74e-3 SMART
RRM 497 567 5.63e-9 SMART
low complexity region 650 675 N/A INTRINSIC
low complexity region 710 718 N/A INTRINSIC
ZnF_U1 797 832 1.87e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190121
SMART Domains Protein: ENSMUSP00000140853
Gene: ENSMUSG00000037236

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
low complexity region 33 48 N/A INTRINSIC
RRM 61 131 3.2e-5 SMART
RRM 159 229 2.4e-11 SMART
low complexity region 312 337 N/A INTRINSIC
low complexity region 372 380 N/A INTRINSIC
ZnF_U1 459 494 1.1e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190458
SMART Domains Protein: ENSMUSP00000139922
Gene: ENSMUSG00000099703

DomainStartEndE-ValueType
low complexity region 23 32 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190570
Predicted Effect probably benign
Transcript: ENSMUST00000190653
SMART Domains Protein: ENSMUSP00000141135
Gene: ENSMUSG00000037236

DomainStartEndE-ValueType
low complexity region 13 23 N/A INTRINSIC
low complexity region 33 48 N/A INTRINSIC
RRM 61 131 3.2e-5 SMART
RRM 159 229 2.4e-11 SMART
low complexity region 312 337 N/A INTRINSIC
low complexity region 372 380 N/A INTRINSIC
ZnF_U1 459 494 1.1e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193225
Meta Mutation Damage Score 0.14 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.5%
  • 10x: 94.1%
  • 20x: 79.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear matrix protein, which is proposed to stabilize certain messenger RNA species. Mutations of this gene are associated with distal myopathy 2, which often includes vocal cord and pharyngeal weakness. Alternatively spliced transcript variants, including read-through transcripts composed of the upstream small nucleolar RNA host gene 4 (non-protein coding) and matrin 3 gene sequence, have been identified. Pseudogenes of this gene are located on chromosomes 1 and X. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a gene-trapped allele are early embryonic lethal. Heterozygotes show congenital heart defects including abnormal heart apex morphology, subaortic ventricular septal defects, double-outlet right ventricle, bicuspid aortic valve, aorta coarctation, and patent ductus arteriosus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik A T 10: 22,067,379 I234N probably benign Het
Actrt3 A G 3: 30,599,698 V51A probably damaging Het
Adgb C T 10: 10,431,281 probably null Het
AI481877 A C 4: 59,093,850 L226R probably damaging Het
Als2 A G 1: 59,211,137 S483P probably damaging Het
Ankrd10 C T 8: 11,615,682 R306H probably damaging Het
Arhgef10 T C 8: 14,975,093 probably null Het
Arhgef10 A G 8: 14,975,666 I459V probably benign Het
Armc2 C T 10: 41,966,700 probably null Het
Atp12a A G 14: 56,386,950 R952G possibly damaging Het
Atp6v1g1 A G 4: 63,550,021 Y87C probably benign Het
Cacna2d1 G A 5: 16,312,568 C404Y probably damaging Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Cd6 A G 19: 10,794,626 I307T possibly damaging Het
Clasrp C A 7: 19,585,240 probably benign Het
Csmd2 T C 4: 128,557,718 F113S unknown Het
Csmd3 C T 15: 47,857,924 G1437D probably damaging Het
Cyp4a14 C A 4: 115,487,301 G456W probably damaging Het
Cyp4a30b A G 4: 115,458,362 H260R possibly damaging Het
Dcp1b C T 6: 119,214,774 S217L probably benign Het
Dhx57 A T 17: 80,251,376 D1051E probably benign Het
Dmp1 A G 5: 104,212,108 S217G probably benign Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Eif4enif1 C T 11: 3,242,586 P805S probably damaging Het
Eral1 A G 11: 78,076,278 I164T possibly damaging Het
Esr1 G A 10: 4,997,890 R481H probably damaging Het
Fam19a2 A T 10: 123,704,365 H42L possibly damaging Het
Fan1 A G 7: 64,363,190 I668T probably benign Het
Gbp11 C T 5: 105,331,000 D191N probably benign Het
Gria2 G A 3: 80,702,492 T670I probably damaging Het
Gria4 T A 9: 4,503,614 N334I probably damaging Het
Grm5 T C 7: 87,602,722 V60A possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ift172 C T 5: 31,257,861 V1335I probably benign Het
Ino80d C T 1: 63,061,039 probably null Het
Kif1c A G 11: 70,724,081 E567G probably damaging Het
Krt31 T G 11: 100,047,873 N298T possibly damaging Het
Mdm1 A G 10: 118,150,942 T267A probably benign Het
Mlxip A G 5: 123,452,667 M878V probably benign Het
Mmp1b A T 9: 7,386,875 silent Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mtor T A 4: 148,540,030 M2089K probably benign Het
Mylk2 A G 2: 152,919,348 K457R probably damaging Het
Nomo1 C A 7: 46,046,937 T293N probably damaging Het
Odf3l2 G A 10: 79,645,653 T14I probably benign Het
Olfr1080 T C 2: 86,553,584 D180G possibly damaging Het
Olfr1510 T G 14: 52,410,861 T4P probably benign Het
Olfr801 A T 10: 129,669,759 C253* probably null Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Otud4 T A 8: 79,661,073 N300K possibly damaging Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Pcdhb20 A T 18: 37,505,780 Q453L possibly damaging Het
Pcdhga9 T A 18: 37,737,471 Y118N possibly damaging Het
Pes1 C A 11: 3,976,834 T372K probably benign Het
Plcl1 A T 1: 55,697,150 D550V probably benign Het
Plekhg5 T A 4: 152,107,503 C433S probably benign Het
Plin2 A G 4: 86,668,678 M1T probably null Het
Ppp1r7 T A 1: 93,357,863 probably null Het
Psmb8 T C 17: 34,200,170 I146T probably damaging Het
Pzp A T 6: 128,485,556 probably null Het
Rel T C 11: 23,761,129 I13V probably benign Het
Reln C T 5: 22,049,791 V527I possibly damaging Het
Retnla A G 16: 48,843,612 R90G probably benign Het
Slc39a8 T A 3: 135,886,793 probably null Het
Slc5a8 A G 10: 88,904,963 I247V probably benign Het
Spcs2 T C 7: 99,839,761 D240G probably damaging Het
St5 A T 7: 109,557,430 Y38N probably benign Het
Stx3 A T 19: 11,789,574 V91D probably damaging Het
Tbc1d8 A G 1: 39,405,317 F187S probably damaging Het
Thbs1 C G 2: 118,119,378 N611K probably damaging Het
Tipin A C 9: 64,304,327 S232R probably benign Het
Tmem132b A G 5: 125,638,268 D347G probably benign Het
Vmn2r68 A C 7: 85,233,626 M306R probably benign Het
Vwa7 G A 17: 35,021,242 M395I probably damaging Het
Ybx3 G A 6: 131,370,413 A253V probably damaging Het
Zfp53 A T 17: 21,508,078 E124D probably benign Het
Other mutations in Matr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01396:Matr3 APN 18 35588389 missense probably damaging 1.00
IGL03083:Matr3 APN 18 35572418 missense probably damaging 0.96
IGL03117:Matr3 APN 18 35572657 missense probably damaging 1.00
IGL03163:Matr3 APN 18 35572591 missense probably damaging 0.99
IGL03381:Matr3 APN 18 35579025 splice site probably benign
R0456:Matr3 UTSW 18 35572864 missense probably damaging 1.00
R1136:Matr3 UTSW 18 35572895 missense probably damaging 1.00
R1459:Matr3 UTSW 18 35584656 missense probably benign 0.28
R1850:Matr3 UTSW 18 35582057 missense probably damaging 1.00
R1929:Matr3 UTSW 18 35588325 splice site probably benign
R2185:Matr3 UTSW 18 35581225 missense probably damaging 1.00
R2366:Matr3 UTSW 18 35588395 missense probably damaging 1.00
R2870:Matr3 UTSW 18 35572296 missense probably benign 0.25
R2871:Matr3 UTSW 18 35572296 missense probably benign 0.25
R2871:Matr3 UTSW 18 35572296 missense probably benign 0.25
R2872:Matr3 UTSW 18 35572296 missense probably benign 0.25
R2872:Matr3 UTSW 18 35572296 missense probably benign 0.25
R2873:Matr3 UTSW 18 35572296 missense probably benign 0.25
R3908:Matr3 UTSW 18 35572841 missense probably damaging 1.00
R4400:Matr3 UTSW 18 35583916 missense possibly damaging 0.80
R4417:Matr3 UTSW 18 35572118 missense probably damaging 1.00
R4860:Matr3 UTSW 18 35581640 missense probably damaging 1.00
R4860:Matr3 UTSW 18 35581640 missense probably damaging 1.00
R4881:Matr3 UTSW 18 35572375 missense probably damaging 1.00
R4908:Matr3 UTSW 18 35572701 missense probably damaging 0.96
R5084:Matr3 UTSW 18 35582082 missense probably damaging 0.99
R5660:Matr3 UTSW 18 35572094 missense probably damaging 0.99
R5709:Matr3 UTSW 18 35581962 missense probably damaging 1.00
R5779:Matr3 UTSW 18 35584522 missense possibly damaging 0.81
R5876:Matr3 UTSW 18 35587738 missense probably benign
R6392:Matr3 UTSW 18 35584841 missense probably benign 0.07
R7062:Matr3 UTSW 18 35579019 critical splice donor site probably null
R7156:Matr3 UTSW 18 35572921 missense probably damaging 0.98
R7228:Matr3 UTSW 18 35562484 missense unknown
R7389:Matr3 UTSW 18 35584585 missense probably benign
Predicted Primers PCR Primer
(F):5'- CAGCAGGAATAGGCCTTCTTG -3'
(R):5'- AATGTAGGGCCTTCTTCAGTTC -3'

Sequencing Primer
(F):5'- GCTGCTACCCAGTCTTTAAGTATG -3'
(R):5'- GTTCTCCTCCTTTTAAGCTGTAGAAG -3'
Posted On2014-12-04