Incidental Mutation 'R2513:Smg6'
ID253661
Institutional Source Beutler Lab
Gene Symbol Smg6
Ensembl Gene ENSMUSG00000038290
Gene NameSmg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)
Synonyms
MMRRC Submission 040419-MU
Accession Numbers

Genbank: NM_001002764.1; Ensembl: ENSMUST00000045281

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2513 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location74925823-75164448 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74929676 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 258 (T258A)
Ref Sequence ENSEMBL: ENSMUSP00000043555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045281] [ENSMUST00000065211] [ENSMUST00000108447] [ENSMUST00000108448] [ENSMUST00000121738] [ENSMUST00000123855] [ENSMUST00000128556] [ENSMUST00000138612]
Predicted Effect probably damaging
Transcript: ENSMUST00000045281
AA Change: T258A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043555
Gene: ENSMUSG00000038290
AA Change: T258A

DomainStartEndE-ValueType
internal_repeat_1 42 99 7.68e-6 PROSPERO
internal_repeat_1 135 188 7.68e-6 PROSPERO
low complexity region 212 227 N/A INTRINSIC
low complexity region 257 271 N/A INTRINSIC
low complexity region 376 390 N/A INTRINSIC
low complexity region 417 426 N/A INTRINSIC
low complexity region 436 453 N/A INTRINSIC
low complexity region 538 549 N/A INTRINSIC
coiled coil region 574 600 N/A INTRINSIC
Pfam:EST1 637 742 1.8e-18 PFAM
Pfam:EST1_DNA_bind 750 1106 1.6e-78 PFAM
coiled coil region 1197 1234 N/A INTRINSIC
PINc 1245 1396 2.85e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000065211
SMART Domains Protein: ENSMUSP00000067552
Gene: ENSMUSG00000001323

DomainStartEndE-ValueType
Pfam:PALP 19 314 3.3e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108447
SMART Domains Protein: ENSMUSP00000104086
Gene: ENSMUSG00000001323

DomainStartEndE-ValueType
Pfam:PALP 19 179 1.8e-41 PFAM
Pfam:PALP 173 289 4.2e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108448
SMART Domains Protein: ENSMUSP00000104087
Gene: ENSMUSG00000001323

DomainStartEndE-ValueType
Pfam:PALP 19 314 2.1e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121738
SMART Domains Protein: ENSMUSP00000113372
Gene: ENSMUSG00000001323

DomainStartEndE-ValueType
Pfam:PALP 19 314 3.3e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000123855
SMART Domains Protein: ENSMUSP00000118485
Gene: ENSMUSG00000001323

DomainStartEndE-ValueType
Pfam:PALP 19 166 1.5e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127499
Predicted Effect probably benign
Transcript: ENSMUST00000128556
SMART Domains Protein: ENSMUSP00000120012
Gene: ENSMUSG00000001323

DomainStartEndE-ValueType
Pfam:PALP 19 182 2.6e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130145
SMART Domains Protein: ENSMUSP00000120229
Gene: ENSMUSG00000038290

DomainStartEndE-ValueType
coiled coil region 35 61 N/A INTRINSIC
Pfam:EST1 99 204 1.3e-19 PFAM
Pfam:EST1_DNA_bind 212 339 7.3e-37 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135587
Predicted Effect probably benign
Transcript: ENSMUST00000138612
SMART Domains Protein: ENSMUSP00000119256
Gene: ENSMUSG00000001323

DomainStartEndE-ValueType
Pfam:PALP 19 112 4.1e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147817
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of the telomerase ribonucleoprotein complex responsible for the replication and maintenance of chromosome ends. The encoded protein also plays a role in the nonsense-mediated mRNA decay (NMD) pathway, providing the endonuclease activity near the premature translation termination codon that is needed to initiate NMD. Alternatively spliced transcript variants encoding distinct protein isoforms have been described. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygosity for insertion of a transgene into intron 6 of the gene results in embryonic lethality. Mice homozygous for a knock-out allele exhibit prenatal lethality. Mice homozygous for a conditional allele activated in embryonic stem cells exhibit defective telomere maintenance and NMD. [provided by MGI curators]
Allele List at MGI

All alleles(52) : Gene trapped(52)

Other mutations in this stock
Total: 90 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik T C 14: 32,661,852 T719A possibly damaging Het
9530053A07Rik C G 7: 28,131,635 S91C probably damaging Het
Abcc1 A G 16: 14,473,009 probably null Het
Aftph C T 11: 20,708,676 probably null Het
Als2 C A 1: 59,215,117 K360N probably benign Het
Atg2a T A 19: 6,258,046 probably null Het
Axl T C 7: 25,787,516 D22G probably benign Het
Baiap2 G A 11: 119,999,226 A438T probably benign Het
Bean1 G C 8: 104,182,011 A7P probably benign Het
Birc6 C G 17: 74,647,729 P3431R probably damaging Het
Camk1d A G 2: 5,714,236 M1T probably null Het
Carmil3 T C 14: 55,503,838 Y1027H probably damaging Het
Ccdc6 G A 10: 70,187,828 probably benign Het
Cemip C A 7: 83,942,025 V1280L probably benign Het
Cfap58 C A 19: 47,962,542 N447K probably benign Het
Chd3 A G 11: 69,360,645 L520P probably damaging Het
Col1a2 T A 6: 4,531,223 probably null Het
Cpne7 A C 8: 123,117,667 probably null Het
Ctla4 T C 1: 60,912,564 V84A probably damaging Het
Dap3 A G 3: 88,928,258 V263A probably benign Het
Dhx57 T A 17: 80,241,949 probably null Het
Dlg5 C A 14: 24,164,525 K663N probably damaging Het
Dsg3 C A 18: 20,523,662 F196L possibly damaging Het
Eif2ak4 C A 2: 118,426,583 D402E probably damaging Het
Fam208b G T 13: 3,582,150 L784I possibly damaging Het
Fance T C 17: 28,318,094 V24A probably benign Het
Fasn A T 11: 120,814,748 L1149Q probably damaging Het
Flg T A 3: 93,279,786 S182T possibly damaging Het
Gm128 T A 3: 95,239,982 S334C possibly damaging Het
Gm3727 A C 14: 7,264,561 H31Q probably damaging Het
Gm4841 T G 18: 60,270,905 T39P probably damaging Het
Golgb1 G T 16: 36,915,151 V1587L possibly damaging Het
Golm1 G A 13: 59,642,258 P243S probably benign Het
Gstcd C A 3: 133,082,320 A206S possibly damaging Het
Gstcd C A 3: 133,082,321 K205N possibly damaging Het
Gtf3c1 A G 7: 125,681,173 V355A probably benign Het
Hhatl T C 9: 121,789,170 D173G probably benign Het
Kcnu1 T A 8: 25,905,966 C660S probably benign Het
Kctd8 T C 5: 69,110,645 D374G probably benign Het
Kif21a T C 15: 90,994,391 I229V possibly damaging Het
L3mbtl1 A T 2: 162,967,585 I702F probably benign Het
Lce1d T C 3: 92,685,759 probably benign Het
Lrig1 C T 6: 94,617,366 probably null Het
Lrp12 A T 15: 39,876,111 D563E probably damaging Het
Lrp2 C T 2: 69,506,374 probably null Het
Map3k5 G A 10: 20,094,455 V703I possibly damaging Het
Mecr A G 4: 131,853,765 R110G probably benign Het
Mtrr T A 13: 68,566,973 K445* probably null Het
Nanos1 T A 19: 60,756,552 L96Q probably benign Het
Olfr538 T G 7: 140,574,156 M1R probably null Het
Olfr574 T A 7: 102,949,493 F333I probably benign Het
Olfr807 T A 10: 129,755,152 L99F probably damaging Het
Otog T C 7: 46,305,590 probably null Het
Pcdhb3 T A 18: 37,301,239 L86* probably null Het
Pcdhb3 A T 18: 37,301,240 L86F probably damaging Het
Pcdhb3 G T 18: 37,301,241 V87F probably benign Het
Pdgfd A G 9: 6,359,894 K322E probably damaging Het
Picalm T C 7: 90,197,009 S648P probably damaging Het
Pigr T C 1: 130,846,620 S446P possibly damaging Het
Pik3cb A C 9: 99,061,842 L636W probably damaging Het
Pla2g2f A T 4: 138,754,162 L92Q probably damaging Het
Plod3 G C 5: 136,988,146 A50P probably benign Het
Prkar2b C T 12: 31,975,929 V191I possibly damaging Het
Prune1 C A 3: 95,258,119 A281S probably benign Het
Ptges3l A T 11: 101,424,042 C42S possibly damaging Het
Reg3b A T 6: 78,371,819 I33L probably benign Het
Rel A G 11: 23,745,823 I188T probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ripor1 G T 8: 105,617,622 V463L probably benign Het
Rrm1 T A 7: 102,460,689 D510E probably damaging Het
Setd7 A G 3: 51,533,015 S202P probably damaging Het
Shank3 T A 15: 89,548,686 D1211E probably benign Het
Slc30a1 A T 1: 191,907,562 T186S possibly damaging Het
Slc4a4 G A 5: 89,156,398 V523I probably benign Het
Slc9a2 T A 1: 40,742,608 probably null Het
Sptlc1 C T 13: 53,337,640 D408N possibly damaging Het
Tbl3 T C 17: 24,704,550 probably null Het
Tdo2 T C 3: 81,969,505 D139G possibly damaging Het
Ticam1 T A 17: 56,271,612 H161L possibly damaging Het
Tnfaip3 T A 10: 19,005,659 D293V probably benign Het
Trim72 G A 7: 128,004,706 V75M possibly damaging Het
Trip11 T A 12: 101,837,727 N1632I possibly damaging Het
Tspan18 A T 2: 93,220,095 M61K possibly damaging Het
Tuba8 A T 6: 121,225,973 E415V probably damaging Het
Ung A G 5: 114,137,192 H214R probably benign Het
Uqcrc1 T C 9: 108,936,768 L17P probably damaging Het
Usp24 A G 4: 106,379,405 probably null Het
Vps39 A C 2: 120,338,787 Y245D probably damaging Het
Whrn T A 4: 63,435,412 T373S probably benign Het
Zc2hc1a C T 3: 7,516,536 probably null Het
Other mutations in Smg6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Smg6 APN 11 74929148 missense probably benign
IGL01146:Smg6 APN 11 74930428 nonsense probably null
IGL01505:Smg6 APN 11 75156291 missense probably damaging 1.00
IGL01541:Smg6 APN 11 74925944 missense probably benign 0.43
IGL01636:Smg6 APN 11 74935103 critical splice donor site probably null
IGL02379:Smg6 APN 11 75053925 missense probably damaging 1.00
IGL02794:Smg6 APN 11 75053934 missense probably damaging 0.99
IGL02964:Smg6 APN 11 74930750 critical splice donor site probably null
IGL03057:Smg6 APN 11 74935434 nonsense probably null
1mM(1):Smg6 UTSW 11 74934989 splice site probably benign
IGL03097:Smg6 UTSW 11 74932426 missense probably damaging 1.00
PIT4802001:Smg6 UTSW 11 75156165 missense probably damaging 0.96
R0269:Smg6 UTSW 11 75162931 missense probably benign
R0344:Smg6 UTSW 11 74929821 missense probably damaging 1.00
R0437:Smg6 UTSW 11 74929701 missense probably damaging 1.00
R0452:Smg6 UTSW 11 74930213 missense probably benign
R0511:Smg6 UTSW 11 74929058 missense probably damaging 1.00
R0617:Smg6 UTSW 11 75162931 missense probably benign
R0737:Smg6 UTSW 11 75159836 missense probably damaging 1.00
R1715:Smg6 UTSW 11 74929430 missense probably benign
R1780:Smg6 UTSW 11 74946116 missense probably damaging 1.00
R1927:Smg6 UTSW 11 75142848 missense probably damaging 1.00
R2073:Smg6 UTSW 11 74930294 missense probably damaging 1.00
R2171:Smg6 UTSW 11 75038646 missense probably damaging 1.00
R3943:Smg6 UTSW 11 74929541 missense probably damaging 1.00
R3944:Smg6 UTSW 11 74929541 missense probably damaging 1.00
R4275:Smg6 UTSW 11 74993874 intron probably benign
R4369:Smg6 UTSW 11 74932443 nonsense probably null
R4452:Smg6 UTSW 11 74990141 missense probably benign 0.14
R4864:Smg6 UTSW 11 74930162 missense possibly damaging 0.89
R4885:Smg6 UTSW 11 75041918 missense probably damaging 1.00
R5043:Smg6 UTSW 11 74929895 missense possibly damaging 0.86
R5189:Smg6 UTSW 11 75041996 missense probably damaging 1.00
R5378:Smg6 UTSW 11 75041994 missense possibly damaging 0.61
R5518:Smg6 UTSW 11 75053898 missense probably damaging 0.99
R5725:Smg6 UTSW 11 74930613 missense probably benign 0.45
R5746:Smg6 UTSW 11 75139287 missense probably damaging 1.00
R6151:Smg6 UTSW 11 75156207 missense probably damaging 0.96
R6319:Smg6 UTSW 11 75156222 missense probably damaging 1.00
R6349:Smg6 UTSW 11 75053774 missense possibly damaging 0.94
R6500:Smg6 UTSW 11 74930505 missense possibly damaging 0.74
R6619:Smg6 UTSW 11 74932453 critical splice donor site probably null
R6820:Smg6 UTSW 11 75041964 missense probably damaging 0.99
R6923:Smg6 UTSW 11 74929343 missense possibly damaging 0.50
R7361:Smg6 UTSW 11 74930153 missense probably benign 0.00
X0018:Smg6 UTSW 11 74929986 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TCAACCAAGTGGAGCAGTTGAG -3'
(R):5'- GGACATCAGGCTCATCAACTC -3'

Sequencing Primer
(F):5'- CCAAGTGGAGCAGTTGAGGATAG -3'
(R):5'- ACTCTGTCCTCATCTAAGGAATCAG -3'
Posted On2014-12-04