Incidental Mutation 'R2516:Afg3l1'
ID253808
Institutional Source Beutler Lab
Gene Symbol Afg3l1
Ensembl Gene ENSMUSG00000031967
Gene NameAFG3-like AAA ATPase 1
Synonyms3110061K15Rik, 1700047G05Rik
MMRRC Submission 040420-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R2516 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location123477903-123503916 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 123501954 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 753 (E753G)
Ref Sequence ENSEMBL: ENSMUSP00000001520 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001520] [ENSMUST00000098320] [ENSMUST00000127664] [ENSMUST00000176155] [ENSMUST00000176286] [ENSMUST00000177240]
Predicted Effect probably damaging
Transcript: ENSMUST00000001520
AA Change: E753G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000001520
Gene: ENSMUSG00000031967
AA Change: E753G

DomainStartEndE-ValueType
low complexity region 79 88 N/A INTRINSIC
low complexity region 106 120 N/A INTRINSIC
Pfam:FtsH_ext 141 235 1.2e-8 PFAM
low complexity region 265 279 N/A INTRINSIC
AAA 332 471 3.67e-24 SMART
Pfam:Peptidase_M41 533 736 6.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098320
SMART Domains Protein: ENSMUSP00000095924
Gene: ENSMUSG00000031967

DomainStartEndE-ValueType
low complexity region 79 88 N/A INTRINSIC
low complexity region 106 120 N/A INTRINSIC
Pfam:FtsH_ext 141 235 6.5e-9 PFAM
low complexity region 265 279 N/A INTRINSIC
AAA 332 471 3.67e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146795
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152469
Predicted Effect probably benign
Transcript: ENSMUST00000176155
SMART Domains Protein: ENSMUSP00000135524
Gene: ENSMUSG00000031970

DomainStartEndE-ValueType
low complexity region 16 31 N/A INTRINSIC
Pfam:Dysbindin 44 189 3.6e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176286
SMART Domains Protein: ENSMUSP00000134757
Gene: ENSMUSG00000031970

DomainStartEndE-ValueType
low complexity region 16 31 N/A INTRINSIC
Pfam:Dysbindin 44 96 3.1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000177240
SMART Domains Protein: ENSMUSP00000135216
Gene: ENSMUSG00000031970

DomainStartEndE-ValueType
low complexity region 16 31 N/A INTRINSIC
Pfam:Dysbindin 44 101 4.5e-10 PFAM
Pfam:Dysbindin 96 142 2.7e-14 PFAM
Meta Mutation Damage Score 0.0288 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (65/66)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and overtly normal with no detectable myelination defects or axonal degeneration in the brain and spinal cord and normal mitochondria in the spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,329,329 I6N possibly damaging Het
Aen T C 7: 78,905,868 V188A probably damaging Het
Alas1 G A 9: 106,238,660 T385I probably damaging Het
Alms1 C A 6: 85,667,963 probably benign Het
Ankrd65 A G 4: 155,791,411 T30A possibly damaging Het
App T C 16: 84,978,229 S582G probably damaging Het
Arfgef1 A T 1: 10,153,654 V1473E possibly damaging Het
Arhgap21 G A 2: 20,854,998 P1196S probably damaging Het
Arhgap24 A G 5: 102,891,910 T238A probably benign Het
Atf7 T C 15: 102,529,004 probably benign Het
Best1 G T 19: 9,993,311 S55* probably null Het
Capn11 A G 17: 45,633,799 V514A probably damaging Het
Cep104 T A 4: 153,989,146 M52K probably damaging Het
Clca3a1 C T 3: 144,737,858 probably null Het
Cyp3a25 T C 5: 146,003,027 probably null Het
Dmxl2 G A 9: 54,400,094 P2197S probably damaging Het
Drosha T C 15: 12,859,465 probably null Het
Exosc9 A G 3: 36,563,162 K355R probably benign Het
Fut1 A C 7: 45,619,198 H192P probably benign Het
Gm572 T A 4: 148,664,384 V166D possibly damaging Het
Gm9966 C T 7: 95,958,528 P19S unknown Het
Gmds C T 13: 32,100,473 V219I probably damaging Het
Gsn G A 2: 35,283,953 E25K probably benign Het
Il4i1 T C 7: 44,839,891 F368S probably damaging Het
Irak1bp1 T C 9: 82,830,320 L98P probably damaging Het
Khdrbs3 T C 15: 69,024,695 probably benign Het
Kndc1 T C 7: 139,921,822 I925T probably damaging Het
Laptm4a T C 12: 8,938,151 I296T probably benign Het
Lpl A T 8: 68,887,518 H55L probably benign Het
Lrrk2 C A 15: 91,755,927 N1558K probably benign Het
Mfsd2a A G 4: 122,950,487 L289P probably damaging Het
Mmrn2 T A 14: 34,398,802 M543K probably benign Het
Mnat1 T C 12: 73,181,776 probably benign Het
Msto1 A T 3: 88,911,893 probably null Het
Mtus1 A G 8: 41,082,739 Y647H probably damaging Het
Nars A T 18: 64,505,016 V289E probably damaging Het
Oit3 T A 10: 59,428,345 K322N probably damaging Het
Oit3 G A 10: 59,441,685 probably benign Het
Olfr1024 A G 2: 85,904,556 I166T probably benign Het
Olfr1467 T A 19: 13,365,193 C188* probably null Het
Olfr728 T C 14: 50,139,983 I219V probably benign Het
Olfr801 G A 10: 129,670,286 R78W probably damaging Het
Pecr A T 1: 72,277,310 C79S probably damaging Het
Plekhn1 T C 4: 156,222,659 D478G probably damaging Het
Pls1 A T 9: 95,776,563 M264K probably benign Het
Ptprj C A 2: 90,474,996 probably benign Het
Pygm A G 19: 6,397,601 D646G probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scn8a T C 15: 100,969,162 V283A probably benign Het
Shisa5 T C 9: 109,056,507 probably null Het
Slc10a4 A G 5: 73,008,505 I246V possibly damaging Het
Slc1a1 A T 19: 28,892,912 I104F probably benign Het
Slc22a8 A G 19: 8,610,195 Y511C probably benign Het
Slc6a5 A G 7: 49,956,462 N706S probably benign Het
Sos2 T C 12: 69,650,659 K96E probably damaging Het
Stom G A 2: 35,315,965 R251* probably null Het
Sycp1 T C 3: 102,845,066 E800G probably benign Het
Tab2 G A 10: 7,907,481 P679L probably damaging Het
Tiam2 G A 17: 3,453,382 V945I probably damaging Het
Trpm5 G T 7: 143,074,517 P1007Q probably damaging Het
Uchl1 T G 5: 66,682,613 I139S probably damaging Het
Vmn1r232 A G 17: 20,914,026 I104T possibly damaging Het
Vmn2r97 G A 17: 18,947,552 M689I probably benign Het
Zc3h18 A T 8: 122,403,165 probably benign Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp456 T C 13: 67,362,372 K99R probably benign Het
Other mutations in Afg3l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Afg3l1 APN 8 123487389 missense probably benign 0.01
IGL01547:Afg3l1 APN 8 123501351 missense probably benign 0.17
IGL01612:Afg3l1 APN 8 123494853 missense probably benign 0.01
IGL01616:Afg3l1 APN 8 123502007 missense probably damaging 1.00
IGL01969:Afg3l1 APN 8 123480431 missense probably damaging 1.00
IGL01996:Afg3l1 APN 8 123501894 missense probably damaging 0.99
IGL02591:Afg3l1 APN 8 123486009 missense probably damaging 1.00
R0370:Afg3l1 UTSW 8 123501554 missense probably damaging 1.00
R1775:Afg3l1 UTSW 8 123492900 missense possibly damaging 0.89
R1817:Afg3l1 UTSW 8 123501931 missense probably damaging 0.99
R2152:Afg3l1 UTSW 8 123494836 missense probably damaging 1.00
R2844:Afg3l1 UTSW 8 123494939 intron probably benign
R3013:Afg3l1 UTSW 8 123484677 missense probably benign 0.27
R3732:Afg3l1 UTSW 8 123501233 missense probably damaging 1.00
R4565:Afg3l1 UTSW 8 123501869 nonsense probably null
R4603:Afg3l1 UTSW 8 123501935 missense probably benign 0.43
R4888:Afg3l1 UTSW 8 123488326 critical splice donor site probably null
R4932:Afg3l1 UTSW 8 123501380 missense probably damaging 1.00
R4970:Afg3l1 UTSW 8 123498653 missense probably benign 0.04
R5027:Afg3l1 UTSW 8 123489814 missense probably benign 0.00
R5133:Afg3l1 UTSW 8 123489793 missense probably benign 0.16
R5457:Afg3l1 UTSW 8 123489968 missense possibly damaging 0.88
R5911:Afg3l1 UTSW 8 123500039 missense possibly damaging 0.79
R6268:Afg3l1 UTSW 8 123492926 missense probably damaging 1.00
R7116:Afg3l1 UTSW 8 123489862 missense probably damaging 0.98
R7303:Afg3l1 UTSW 8 123501269 missense probably damaging 1.00
Z1088:Afg3l1 UTSW 8 123488242 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- ATCAGGACCACTAAGTGCATCC -3'
(R):5'- CGTGTGTTCGAAGTTGTCAC -3'

Sequencing Primer
(F):5'- ACTAAGTGCATCCGGGTCCTG -3'
(R):5'- TCTGACAGCTGCTCTGCGATG -3'
Posted On2014-12-04