Incidental Mutation 'R0314:Gm12169'
ID25381
Institutional Source Beutler Lab
Gene Symbol Gm12169
Ensembl Gene ENSMUSG00000078924
Gene Namepredicted gene 12169
Synonyms
MMRRC Submission 038524-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R0314 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location46524212-46538156 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 46528537 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 60 (C60Y)
Ref Sequence ENSEMBL: ENSMUSP00000104851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109228]
Predicted Effect probably damaging
Transcript: ENSMUST00000109228
AA Change: C60Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104851
Gene: ENSMUSG00000078924
AA Change: C60Y

DomainStartEndE-ValueType
IG 22 128 3.76e-8 SMART
transmembrane domain 159 181 N/A INTRINSIC
Meta Mutation Damage Score 0.404 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.9%
  • 20x: 88.7%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arih2 T C 9: 108,608,679 N345D probably damaging Het
Ascc3 C T 10: 50,637,999 S298L possibly damaging Het
Cacna1e A G 1: 154,442,251 Y1462H probably damaging Het
Car9 T C 4: 43,509,212 probably null Het
Cenpc1 A T 5: 86,037,371 M427K probably benign Het
Chl1 T A 6: 103,647,301 C57S probably damaging Het
Cntn3 T C 6: 102,420,381 Y77C probably damaging Het
Cobll1 T C 2: 65,089,521 K1187E possibly damaging Het
Fkbpl C T 17: 34,646,052 H265Y possibly damaging Het
Fmo1 T G 1: 162,859,462 E32A probably damaging Het
Fnip2 G A 3: 79,481,189 T715I probably damaging Het
Fzd6 T A 15: 39,025,733 I82K possibly damaging Het
Grm5 T C 7: 87,602,955 S138P probably damaging Het
Klra5 T C 6: 129,903,590 Y115C probably damaging Het
Lgr4 T C 2: 109,991,093 probably benign Het
Limd1 T G 9: 123,516,827 I557S probably benign Het
Mpv17l A T 16: 13,940,999 I96L probably benign Het
Neb A T 2: 52,243,331 D3398E probably benign Het
Nup155 T C 15: 8,147,252 S1005P probably benign Het
Olfr1396 A T 11: 49,113,692 D11E possibly damaging Het
Olfr69 T C 7: 103,768,181 D72G probably damaging Het
Pebp4 G T 14: 70,059,654 S214I possibly damaging Het
Pex26 T C 6: 121,184,484 probably null Het
Rbbp8 A T 18: 11,715,818 Q230L probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Robo2 G A 16: 73,956,637 T784M probably damaging Het
Slc5a1 T C 5: 33,146,651 I270T probably benign Het
Spag4 C T 2: 156,067,309 probably benign Het
Stt3a T C 9: 36,749,545 probably benign Het
Svep1 C T 4: 58,096,331 E1430K possibly damaging Het
Uba6 A T 5: 86,118,087 V956E probably damaging Het
Ube2j1 T A 4: 33,043,991 probably benign Het
Ubr5 A G 15: 37,997,187 S1741P probably damaging Het
Vmn2r1 A G 3: 64,086,559 T109A probably damaging Het
Vmn2r60 T C 7: 42,135,561 probably benign Het
Vstm2a A G 11: 16,368,388 probably benign Het
Zdhhc20 T A 14: 57,856,619 K195N probably damaging Het
Zfp683 A G 4: 134,058,741 Y393C probably benign Het
Zzz3 T C 3: 152,427,448 S48P probably benign Het
Other mutations in Gm12169
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0959:Gm12169 UTSW 11 46536420 nonsense probably null
R1602:Gm12169 UTSW 11 46535588 missense probably benign 0.00
R1719:Gm12169 UTSW 11 46526294 missense probably damaging 1.00
R1917:Gm12169 UTSW 11 46528531 missense possibly damaging 0.82
R1918:Gm12169 UTSW 11 46528531 missense possibly damaging 0.82
R1919:Gm12169 UTSW 11 46528531 missense possibly damaging 0.82
R2202:Gm12169 UTSW 11 46528567 missense probably benign 0.06
R2205:Gm12169 UTSW 11 46528567 missense probably benign 0.06
R3964:Gm12169 UTSW 11 46535513 missense possibly damaging 0.56
R3965:Gm12169 UTSW 11 46535513 missense possibly damaging 0.56
R3966:Gm12169 UTSW 11 46535513 missense possibly damaging 0.56
R5022:Gm12169 UTSW 11 46528532 missense probably damaging 0.97
R5023:Gm12169 UTSW 11 46528532 missense probably damaging 0.97
R7294:Gm12169 UTSW 11 46535612 missense probably benign 0.41
Predicted Primers PCR Primer
(F):5'- CCTGTGTCAGGTTTAATCCACAGTTGA -3'
(R):5'- ACTCTGTGCCCGAAAAGCTGTT -3'

Sequencing Primer
(F):5'- GTTTAATCCACAGTTGAGCCAG -3'
(R):5'- accaggaggacacggac -3'
Posted On2013-04-16