Incidental Mutation 'R0314:Olfr1396'
ID25382
Institutional Source Beutler Lab
Gene Symbol Olfr1396
Ensembl Gene ENSMUSG00000047511
Gene Nameolfactory receptor 1396
SynonymsGA_x6K02T2QP88-6321048-6321995, MOR276-2
MMRRC Submission 038524-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R0314 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location49109982-49114874 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 49113692 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 11 (D11E)
Ref Sequence ENSEMBL: ENSMUSP00000150961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056759] [ENSMUST00000060398] [ENSMUST00000102785] [ENSMUST00000109201] [ENSMUST00000179282] [ENSMUST00000203007] [ENSMUST00000203149] [ENSMUST00000203810] [ENSMUST00000215553]
Predicted Effect probably benign
Transcript: ENSMUST00000056759
SMART Domains Protein: ENSMUSP00000058544
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 4 227 5.7e-7 PFAM
Pfam:7tm_1 10 259 1.5e-33 PFAM
Pfam:7tm_4 108 252 1.7e-46 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000060398
AA Change: D11E

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000056876
Gene: ENSMUSG00000047511
AA Change: D11E

DomainStartEndE-ValueType
Pfam:7tm_4 40 319 3.2e-46 PFAM
Pfam:7tm_1 53 302 7.3e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102785
SMART Domains Protein: ENSMUSP00000099846
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 4 227 5.7e-7 PFAM
Pfam:7tm_1 10 259 1.5e-33 PFAM
Pfam:7tm_4 108 252 1.7e-46 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109201
AA Change: D11E

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104824
Gene: ENSMUSG00000047511
AA Change: D11E

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 36 252 1e-5 PFAM
Pfam:7tm_1 42 291 4e-35 PFAM
Pfam:7tm_4 140 284 5.3e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179282
SMART Domains Protein: ENSMUSP00000136647
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7tm_4 1 276 3.6e-51 PFAM
Pfam:7TM_GPCR_Srsx 4 227 5.7e-7 PFAM
Pfam:7tm_1 10 259 3.8e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000203007
AA Change: D11E

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000145057
Gene: ENSMUSG00000047511
AA Change: D11E

DomainStartEndE-ValueType
Pfam:7tm_4 29 308 9.6e-47 PFAM
Pfam:7TM_GPCR_Srsx 36 252 1e-5 PFAM
Pfam:7tm_1 42 291 3.1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203149
SMART Domains Protein: ENSMUSP00000145429
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2.6e-51 PFAM
Pfam:7TM_GPCR_Srsx 36 253 3.8e-7 PFAM
Pfam:7tm_1 42 291 2.5e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203412
Predicted Effect probably benign
Transcript: ENSMUST00000203810
SMART Domains Protein: ENSMUSP00000144951
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 2.6e-51 PFAM
Pfam:7TM_GPCR_Srsx 36 253 3.8e-7 PFAM
Pfam:7tm_1 42 291 2.5e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000215553
AA Change: D11E

PolyPhen 2 Score 0.539 (Sensitivity: 0.88; Specificity: 0.90)
Meta Mutation Damage Score 0.164 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.9%
  • 20x: 88.7%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arih2 T C 9: 108,608,679 N345D probably damaging Het
Ascc3 C T 10: 50,637,999 S298L possibly damaging Het
Cacna1e A G 1: 154,442,251 Y1462H probably damaging Het
Car9 T C 4: 43,509,212 probably null Het
Cenpc1 A T 5: 86,037,371 M427K probably benign Het
Chl1 T A 6: 103,647,301 C57S probably damaging Het
Cntn3 T C 6: 102,420,381 Y77C probably damaging Het
Cobll1 T C 2: 65,089,521 K1187E possibly damaging Het
Fkbpl C T 17: 34,646,052 H265Y possibly damaging Het
Fmo1 T G 1: 162,859,462 E32A probably damaging Het
Fnip2 G A 3: 79,481,189 T715I probably damaging Het
Fzd6 T A 15: 39,025,733 I82K possibly damaging Het
Gm12169 G A 11: 46,528,537 C60Y probably damaging Het
Grm5 T C 7: 87,602,955 S138P probably damaging Het
Klra5 T C 6: 129,903,590 Y115C probably damaging Het
Lgr4 T C 2: 109,991,093 probably benign Het
Limd1 T G 9: 123,516,827 I557S probably benign Het
Mpv17l A T 16: 13,940,999 I96L probably benign Het
Neb A T 2: 52,243,331 D3398E probably benign Het
Nup155 T C 15: 8,147,252 S1005P probably benign Het
Olfr69 T C 7: 103,768,181 D72G probably damaging Het
Pebp4 G T 14: 70,059,654 S214I possibly damaging Het
Pex26 T C 6: 121,184,484 probably null Het
Rbbp8 A T 18: 11,715,818 Q230L probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Robo2 G A 16: 73,956,637 T784M probably damaging Het
Slc5a1 T C 5: 33,146,651 I270T probably benign Het
Spag4 C T 2: 156,067,309 probably benign Het
Stt3a T C 9: 36,749,545 probably benign Het
Svep1 C T 4: 58,096,331 E1430K possibly damaging Het
Uba6 A T 5: 86,118,087 V956E probably damaging Het
Ube2j1 T A 4: 33,043,991 probably benign Het
Ubr5 A G 15: 37,997,187 S1741P probably damaging Het
Vmn2r1 A G 3: 64,086,559 T109A probably damaging Het
Vmn2r60 T C 7: 42,135,561 probably benign Het
Vstm2a A G 11: 16,368,388 probably benign Het
Zdhhc20 T A 14: 57,856,619 K195N probably damaging Het
Zfp683 A G 4: 134,058,741 Y393C probably benign Het
Zzz3 T C 3: 152,427,448 S48P probably benign Het
Other mutations in Olfr1396
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Olfr1396 APN 11 49112853 missense probably damaging 1.00
IGL01514:Olfr1396 APN 11 49113576 missense probably damaging 1.00
IGL03188:Olfr1396 APN 11 49113709 missense probably damaging 1.00
R1242:Olfr1396 UTSW 11 49112901 missense possibly damaging 0.95
R1625:Olfr1396 UTSW 11 49113244 missense probably benign 0.01
R2212:Olfr1396 UTSW 11 49113216 missense probably damaging 1.00
R4290:Olfr1396 UTSW 11 49113427 missense probably benign 0.00
R4291:Olfr1396 UTSW 11 49113427 missense probably benign 0.00
R4292:Olfr1396 UTSW 11 49113427 missense probably benign 0.00
R4294:Olfr1396 UTSW 11 49113427 missense probably benign 0.00
R4295:Olfr1396 UTSW 11 49113427 missense probably benign 0.00
R4351:Olfr1396 UTSW 11 49113703 missense probably damaging 0.99
R4817:Olfr1396 UTSW 11 49113621 missense probably damaging 1.00
R4859:Olfr1396 UTSW 11 49113166 missense probably damaging 1.00
R5245:Olfr1396 UTSW 11 49113289 missense probably benign 0.12
R5350:Olfr1396 UTSW 11 49113052 missense probably benign 0.00
R6625:Olfr1396 UTSW 11 49113069 missense probably damaging 1.00
X0024:Olfr1396 UTSW 11 49113311 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- GTTGACTGCCATCTTTGGCACATTG -3'
(R):5'- GGGAGATTGCTCTTTCCAGGAAGTG -3'

Sequencing Primer
(F):5'- TTGGCACATTGGTACAGACC -3'
(R):5'- CTTTCCAGGAAGTGGGATAAAATTGC -3'
Posted On2013-04-16