Incidental Mutation 'R2516:Olfr801'
ID253825
Institutional Source Beutler Lab
Gene Symbol Olfr801
Ensembl Gene ENSMUSG00000058513
Gene Nameolfactory receptor 801
SynonymsGA_x6K02T2PULF-11349138-11348182, MOR110-10
MMRRC Submission 040420-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.040) question?
Stock #R2516 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129666989-129673865 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 129670286 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 78 (R78W)
Ref Sequence ENSEMBL: ENSMUSP00000149555 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072063] [ENSMUST00000203424] [ENSMUST00000213294] [ENSMUST00000216067]
Predicted Effect probably damaging
Transcript: ENSMUST00000072063
AA Change: R78W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071941
Gene: ENSMUSG00000058513
AA Change: R78W

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 1.2e-51 PFAM
Pfam:7tm_1 39 288 8.8e-25 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203321
Predicted Effect probably damaging
Transcript: ENSMUST00000203424
AA Change: R41W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000145011
Gene: ENSMUSG00000058513
AA Change: R41W

DomainStartEndE-ValueType
Pfam:7tm_4 1 96 5.9e-18 PFAM
Pfam:7tm_1 2 96 1.3e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213294
AA Change: R78W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216067
AA Change: R78W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.0316 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (65/66)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,329,329 I6N possibly damaging Het
Aen T C 7: 78,905,868 V188A probably damaging Het
Afg3l1 A G 8: 123,501,954 E753G probably damaging Het
Alas1 G A 9: 106,238,660 T385I probably damaging Het
Alms1 C A 6: 85,667,963 probably benign Het
Ankrd65 A G 4: 155,791,411 T30A possibly damaging Het
App T C 16: 84,978,229 S582G probably damaging Het
Arfgef1 A T 1: 10,153,654 V1473E possibly damaging Het
Arhgap21 G A 2: 20,854,998 P1196S probably damaging Het
Arhgap24 A G 5: 102,891,910 T238A probably benign Het
Atf7 T C 15: 102,529,004 probably benign Het
Best1 G T 19: 9,993,311 S55* probably null Het
Capn11 A G 17: 45,633,799 V514A probably damaging Het
Cep104 T A 4: 153,989,146 M52K probably damaging Het
Clca3a1 C T 3: 144,737,858 probably null Het
Cyp3a25 T C 5: 146,003,027 probably null Het
Dmxl2 G A 9: 54,400,094 P2197S probably damaging Het
Drosha T C 15: 12,859,465 probably null Het
Exosc9 A G 3: 36,563,162 K355R probably benign Het
Fut1 A C 7: 45,619,198 H192P probably benign Het
Gm572 T A 4: 148,664,384 V166D possibly damaging Het
Gm9966 C T 7: 95,958,528 P19S unknown Het
Gmds C T 13: 32,100,473 V219I probably damaging Het
Gsn G A 2: 35,283,953 E25K probably benign Het
Il4i1 T C 7: 44,839,891 F368S probably damaging Het
Irak1bp1 T C 9: 82,830,320 L98P probably damaging Het
Khdrbs3 T C 15: 69,024,695 probably benign Het
Kndc1 T C 7: 139,921,822 I925T probably damaging Het
Laptm4a T C 12: 8,938,151 I296T probably benign Het
Lpl A T 8: 68,887,518 H55L probably benign Het
Lrrk2 C A 15: 91,755,927 N1558K probably benign Het
Mfsd2a A G 4: 122,950,487 L289P probably damaging Het
Mmrn2 T A 14: 34,398,802 M543K probably benign Het
Mnat1 T C 12: 73,181,776 probably benign Het
Msto1 A T 3: 88,911,893 probably null Het
Mtus1 A G 8: 41,082,739 Y647H probably damaging Het
Nars A T 18: 64,505,016 V289E probably damaging Het
Oit3 T A 10: 59,428,345 K322N probably damaging Het
Oit3 G A 10: 59,441,685 probably benign Het
Olfr1024 A G 2: 85,904,556 I166T probably benign Het
Olfr1467 T A 19: 13,365,193 C188* probably null Het
Olfr728 T C 14: 50,139,983 I219V probably benign Het
Pecr A T 1: 72,277,310 C79S probably damaging Het
Plekhn1 T C 4: 156,222,659 D478G probably damaging Het
Pls1 A T 9: 95,776,563 M264K probably benign Het
Ptprj C A 2: 90,474,996 probably benign Het
Pygm A G 19: 6,397,601 D646G probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Scn8a T C 15: 100,969,162 V283A probably benign Het
Shisa5 T C 9: 109,056,507 probably null Het
Slc10a4 A G 5: 73,008,505 I246V possibly damaging Het
Slc1a1 A T 19: 28,892,912 I104F probably benign Het
Slc22a8 A G 19: 8,610,195 Y511C probably benign Het
Slc6a5 A G 7: 49,956,462 N706S probably benign Het
Sos2 T C 12: 69,650,659 K96E probably damaging Het
Stom G A 2: 35,315,965 R251* probably null Het
Sycp1 T C 3: 102,845,066 E800G probably benign Het
Tab2 G A 10: 7,907,481 P679L probably damaging Het
Tiam2 G A 17: 3,453,382 V945I probably damaging Het
Trpm5 G T 7: 143,074,517 P1007Q probably damaging Het
Uchl1 T G 5: 66,682,613 I139S probably damaging Het
Vmn1r232 A G 17: 20,914,026 I104T possibly damaging Het
Vmn2r97 G A 17: 18,947,552 M689I probably benign Het
Zc3h18 A T 8: 122,403,165 probably benign Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp456 T C 13: 67,362,372 K99R probably benign Het
Other mutations in Olfr801
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00948:Olfr801 APN 10 129669887 missense probably damaging 1.00
IGL02400:Olfr801 APN 10 129669883 missense probably damaging 0.99
IGL02721:Olfr801 APN 10 129670123 missense probably benign 0.08
IGL03107:Olfr801 APN 10 129669940 missense probably benign 0.00
R0114:Olfr801 UTSW 10 129669598 missense probably benign
R0140:Olfr801 UTSW 10 129669688 missense probably damaging 1.00
R0652:Olfr801 UTSW 10 129670379 missense probably benign 0.08
R1375:Olfr801 UTSW 10 129670372 missense probably null 0.97
R1449:Olfr801 UTSW 10 129670369 missense probably damaging 0.99
R2026:Olfr801 UTSW 10 129670465 missense probably damaging 1.00
R2241:Olfr801 UTSW 10 129669895 missense probably damaging 1.00
R2869:Olfr801 UTSW 10 129669759 nonsense probably null
R2869:Olfr801 UTSW 10 129669759 nonsense probably null
R2870:Olfr801 UTSW 10 129669759 nonsense probably null
R2870:Olfr801 UTSW 10 129669759 nonsense probably null
R2873:Olfr801 UTSW 10 129669759 nonsense probably null
R6562:Olfr801 UTSW 10 129670139 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAGTCCCAACACTAAAGGG -3'
(R):5'- TGACAGATGACCCTCAGCTAC -3'

Sequencing Primer
(F):5'- CCAGTAGGTGACACATTCTGTTG -3'
(R):5'- GATGACCCTCAGCTACAAATTCTG -3'
Posted On2014-12-04