Incidental Mutation 'R0314:Ubr5'
ID25385
Institutional Source Beutler Lab
Gene Symbol Ubr5
Ensembl Gene ENSMUSG00000037487
Gene Nameubiquitin protein ligase E3 component n-recognin 5
SynonymsEdd, 4432411E13Rik, Edd1
MMRRC Submission 038524-MU
Accession Numbers

NCBI RefSeq: NM_001081359.2, NM_001112721.1; MGI:1918040

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0314 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location37967328-38078854 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37997187 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1741 (S1741P)
Ref Sequence ENSEMBL: ENSMUSP00000154293 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110336] [ENSMUST00000226414]
Predicted Effect possibly damaging
Transcript: ENSMUST00000110336
AA Change: S1735P

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105965
Gene: ENSMUSG00000037487
AA Change: S1735P

DomainStartEndE-ValueType
low complexity region 94 111 N/A INTRINSIC
low complexity region 129 156 N/A INTRINSIC
Pfam:E3_UbLigase_EDD 179 230 9.7e-35 PFAM
low complexity region 282 323 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
low complexity region 860 870 N/A INTRINSIC
low complexity region 933 950 N/A INTRINSIC
low complexity region 970 999 N/A INTRINSIC
low complexity region 1140 1151 N/A INTRINSIC
ZnF_UBR1 1177 1244 5.42e-27 SMART
low complexity region 1396 1405 N/A INTRINSIC
low complexity region 1524 1537 N/A INTRINSIC
low complexity region 1567 1613 N/A INTRINSIC
low complexity region 1641 1657 N/A INTRINSIC
low complexity region 1662 1687 N/A INTRINSIC
low complexity region 1726 1742 N/A INTRINSIC
low complexity region 1759 1789 N/A INTRINSIC
low complexity region 1879 1890 N/A INTRINSIC
low complexity region 1972 1983 N/A INTRINSIC
low complexity region 1986 1997 N/A INTRINSIC
Blast:HECTc 2271 2313 2e-6 BLAST
low complexity region 2329 2366 N/A INTRINSIC
PolyA 2389 2452 3.97e-33 SMART
HECTc 2432 2798 1e-151 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226137
Predicted Effect probably damaging
Transcript: ENSMUST00000226414
AA Change: S1741P

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228174
Meta Mutation Damage Score 0.312 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.8%
  • 10x: 94.9%
  • 20x: 88.7%
Validation Efficiency 100% (41/41)
MGI Phenotype Strain: 3052764
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a progestin-induced protein, which belongs to the HECT (homology to E6-AP carboxyl terminus) family. The HECT family proteins function as E3 ubiquitin-protein ligases, targeting specific proteins for ubiquitin-mediated proteolysis. This gene is localized to chromosome 8q22 which is disrupted in a variety of cancers. This gene potentially has a role in regulation of cell proliferation or differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis, impaired growth of the allantois, failure or impairment of chorioallantoic fusion, impaired angiogenesis in the yolk sac and allantois, decreased cell proliferation, and increased apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(151) : Targeted(3) Gene trapped(148)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arih2 T C 9: 108,608,679 N345D probably damaging Het
Ascc3 C T 10: 50,637,999 S298L possibly damaging Het
Cacna1e A G 1: 154,442,251 Y1462H probably damaging Het
Car9 T C 4: 43,509,212 probably null Het
Cenpc1 A T 5: 86,037,371 M427K probably benign Het
Chl1 T A 6: 103,647,301 C57S probably damaging Het
Cntn3 T C 6: 102,420,381 Y77C probably damaging Het
Cobll1 T C 2: 65,089,521 K1187E possibly damaging Het
Fkbpl C T 17: 34,646,052 H265Y possibly damaging Het
Fmo1 T G 1: 162,859,462 E32A probably damaging Het
Fnip2 G A 3: 79,481,189 T715I probably damaging Het
Fzd6 T A 15: 39,025,733 I82K possibly damaging Het
Gm12169 G A 11: 46,528,537 C60Y probably damaging Het
Grm5 T C 7: 87,602,955 S138P probably damaging Het
Klra5 T C 6: 129,903,590 Y115C probably damaging Het
Lgr4 T C 2: 109,991,093 probably benign Het
Limd1 T G 9: 123,516,827 I557S probably benign Het
Mpv17l A T 16: 13,940,999 I96L probably benign Het
Neb A T 2: 52,243,331 D3398E probably benign Het
Nup155 T C 15: 8,147,252 S1005P probably benign Het
Olfr1396 A T 11: 49,113,692 D11E possibly damaging Het
Olfr69 T C 7: 103,768,181 D72G probably damaging Het
Pebp4 G T 14: 70,059,654 S214I possibly damaging Het
Pex26 T C 6: 121,184,484 probably null Het
Rbbp8 A T 18: 11,715,818 Q230L probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Robo2 G A 16: 73,956,637 T784M probably damaging Het
Slc5a1 T C 5: 33,146,651 I270T probably benign Het
Spag4 C T 2: 156,067,309 probably benign Het
Stt3a T C 9: 36,749,545 probably benign Het
Svep1 C T 4: 58,096,331 E1430K possibly damaging Het
Uba6 A T 5: 86,118,087 V956E probably damaging Het
Ube2j1 T A 4: 33,043,991 probably benign Het
Vmn2r1 A G 3: 64,086,559 T109A probably damaging Het
Vmn2r60 T C 7: 42,135,561 probably benign Het
Vstm2a A G 11: 16,368,388 probably benign Het
Zdhhc20 T A 14: 57,856,619 K195N probably damaging Het
Zfp683 A G 4: 134,058,741 Y393C probably benign Het
Zzz3 T C 3: 152,427,448 S48P probably benign Het
Other mutations in Ubr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Ubr5 APN 15 37984036 missense probably damaging 1.00
IGL00548:Ubr5 APN 15 38004321 missense probably benign 0.11
IGL00675:Ubr5 APN 15 38018284 missense possibly damaging 0.84
IGL00770:Ubr5 APN 15 38006541 missense probably benign 0.27
IGL00774:Ubr5 APN 15 38006541 missense probably benign 0.27
IGL00919:Ubr5 APN 15 38040842 missense probably damaging 1.00
IGL00962:Ubr5 APN 15 37985934 missense probably damaging 1.00
IGL01328:Ubr5 APN 15 37981523 missense possibly damaging 0.82
IGL01359:Ubr5 APN 15 37973006 missense probably damaging 0.96
IGL01394:Ubr5 APN 15 38009631 missense possibly damaging 0.90
IGL01674:Ubr5 APN 15 37998379 missense probably damaging 1.00
IGL01981:Ubr5 APN 15 37996598 missense probably benign 0.08
IGL01993:Ubr5 APN 15 37973012 missense probably damaging 0.99
IGL02159:Ubr5 APN 15 37991379 splice site probably benign
IGL02252:Ubr5 APN 15 38024894 missense probably damaging 1.00
IGL02442:Ubr5 APN 15 38037901 missense possibly damaging 0.95
IGL02502:Ubr5 APN 15 38030689 missense probably benign 0.01
IGL02503:Ubr5 APN 15 38018320 missense possibly damaging 0.90
IGL02503:Ubr5 APN 15 38018314 missense probably damaging 0.99
IGL02546:Ubr5 APN 15 38008747 missense probably benign 0.00
IGL02556:Ubr5 APN 15 38002448 missense probably benign 0.18
IGL02647:Ubr5 APN 15 37992082 missense probably damaging 0.99
IGL02679:Ubr5 APN 15 38002314 missense probably benign 0.36
IGL02726:Ubr5 APN 15 38000562 splice site probably benign
IGL02884:Ubr5 APN 15 37998376 missense probably damaging 1.00
IGL02972:Ubr5 APN 15 38041952 missense probably damaging 1.00
IGL03000:Ubr5 APN 15 38024852 missense probably damaging 0.99
IGL03028:Ubr5 APN 15 38047593 missense probably benign 0.00
IGL03057:Ubr5 APN 15 38040906 splice site probably benign
IGL03085:Ubr5 APN 15 38029568 missense probably damaging 1.00
IGL03198:Ubr5 APN 15 38045720 missense probably damaging 1.00
IGL03368:Ubr5 APN 15 37998316 missense probably damaging 0.96
P0016:Ubr5 UTSW 15 38000578 missense probably damaging 1.00
PIT4142001:Ubr5 UTSW 15 38041909 missense probably damaging 0.98
R0133:Ubr5 UTSW 15 37996571 missense probably damaging 0.98
R0173:Ubr5 UTSW 15 38004675 missense probably damaging 1.00
R0234:Ubr5 UTSW 15 37968493 missense probably damaging 1.00
R0234:Ubr5 UTSW 15 37968493 missense probably damaging 1.00
R0379:Ubr5 UTSW 15 38018957 missense probably benign 0.00
R0390:Ubr5 UTSW 15 38030672 missense probably benign 0.19
R0415:Ubr5 UTSW 15 37972980 missense probably damaging 0.98
R0531:Ubr5 UTSW 15 37991344 missense probably benign 0.34
R0650:Ubr5 UTSW 15 38030807 splice site probably benign
R0720:Ubr5 UTSW 15 37972991 missense probably damaging 0.98
R1183:Ubr5 UTSW 15 37997175 missense possibly damaging 0.71
R1302:Ubr5 UTSW 15 38041479 missense possibly damaging 0.91
R1442:Ubr5 UTSW 15 38014924 splice site probably benign
R1507:Ubr5 UTSW 15 37980870 missense probably damaging 1.00
R1575:Ubr5 UTSW 15 38040841 missense probably damaging 1.00
R1577:Ubr5 UTSW 15 38030730 missense possibly damaging 0.76
R1622:Ubr5 UTSW 15 38009113 unclassified probably benign
R1721:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R1799:Ubr5 UTSW 15 37989377 missense probably damaging 1.00
R1840:Ubr5 UTSW 15 37980917 missense possibly damaging 0.51
R1867:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R1868:Ubr5 UTSW 15 38041846 missense probably benign 0.18
R2065:Ubr5 UTSW 15 38040842 missense probably damaging 1.00
R2107:Ubr5 UTSW 15 37989302 missense probably benign 0.00
R2201:Ubr5 UTSW 15 38002299 missense possibly damaging 0.83
R2261:Ubr5 UTSW 15 37988284 missense probably damaging 0.99
R2441:Ubr5 UTSW 15 37989345 missense probably damaging 0.99
R2512:Ubr5 UTSW 15 38002319 missense probably damaging 1.00
R3008:Ubr5 UTSW 15 38030845 missense probably benign
R3412:Ubr5 UTSW 15 38004235 splice site probably benign
R3898:Ubr5 UTSW 15 37997739 missense probably benign 0.02
R3900:Ubr5 UTSW 15 38019242 missense probably damaging 1.00
R4032:Ubr5 UTSW 15 38024837 missense probably benign 0.22
R4352:Ubr5 UTSW 15 38041573 missense probably benign 0.31
R4362:Ubr5 UTSW 15 38078403 missense probably damaging 0.99
R4467:Ubr5 UTSW 15 38004336 missense probably damaging 1.00
R4507:Ubr5 UTSW 15 38013542 missense probably damaging 0.96
R4683:Ubr5 UTSW 15 38037967 missense probably damaging 1.00
R4771:Ubr5 UTSW 15 38018297 missense possibly damaging 0.50
R4878:Ubr5 UTSW 15 38006564 missense probably benign 0.01
R4999:Ubr5 UTSW 15 38009668 missense probably benign 0.06
R5057:Ubr5 UTSW 15 38004109 missense probably damaging 0.98
R5177:Ubr5 UTSW 15 38006517 missense probably benign 0.22
R5186:Ubr5 UTSW 15 37997916 missense probably damaging 0.99
R5378:Ubr5 UTSW 15 37989578 missense probably damaging 1.00
R5486:Ubr5 UTSW 15 38008739 missense probably benign 0.00
R5494:Ubr5 UTSW 15 38019281 missense possibly damaging 0.78
R5617:Ubr5 UTSW 15 38030657 missense possibly damaging 0.47
R5636:Ubr5 UTSW 15 37983996 missense probably damaging 1.00
R5655:Ubr5 UTSW 15 38015093 missense probably damaging 0.99
R5715:Ubr5 UTSW 15 38002233 missense probably benign 0.06
R5781:Ubr5 UTSW 15 38006541 missense probably benign 0.27
R6645:Ubr5 UTSW 15 38029506 missense probably damaging 1.00
R6774:Ubr5 UTSW 15 38015135 missense probably damaging 1.00
R6823:Ubr5 UTSW 15 37989598 missense probably benign 0.08
R6877:Ubr5 UTSW 15 38002570 missense probably damaging 0.98
R7105:Ubr5 UTSW 15 38008775 missense
X0024:Ubr5 UTSW 15 37992060 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGATGACAATGCTGTAAGCCCTG -3'
(R):5'- GCTAAAAGTGTCTGCACACATTGCC -3'

Sequencing Primer
(F):5'- TGTAAGCCCTGGCTAAACTG -3'
(R):5'- GTCTGCACACATTGCCAGATG -3'
Posted On2013-04-16