Incidental Mutation 'R2872:Olfr654'
ID253886
Institutional Source Beutler Lab
Gene Symbol Olfr654
Ensembl Gene ENSMUSG00000073925
Gene Nameolfactory receptor 654
SynonymsGA_x6K02T2PBJ9-7215221-7216195, MOR38-2
MMRRC Submission 040460-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R2872 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location104587025-104590718 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104588493 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 230 (S230P)
Ref Sequence ENSEMBL: ENSMUSP00000149640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098173] [ENSMUST00000210457] [ENSMUST00000213984] [ENSMUST00000215585] [ENSMUST00000217466]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098173
AA Change: S247P

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095775
Gene: ENSMUSG00000073925
AA Change: S247P

DomainStartEndE-ValueType
low complexity region 3 17 N/A INTRINSIC
Pfam:7TM_GPCR_Srbc 43 176 2.5e-8 PFAM
Pfam:7tm_4 49 328 1.7e-103 PFAM
Pfam:7TM_GPCR_Srsx 53 325 1.6e-7 PFAM
Pfam:7tm_1 59 310 9.2e-22 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000210457
AA Change: S230P

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000213984
AA Change: S230P

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000215585
Predicted Effect probably benign
Transcript: ENSMUST00000217466
Meta Mutation Damage Score 0.0624 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.6%
  • 10x: 94.5%
  • 20x: 80.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,955,176 C811R possibly damaging Het
AI481877 A C 4: 59,093,850 L226R probably damaging Het
Ak8 T C 2: 28,742,720 I317T possibly damaging Het
Als2 A G 1: 59,211,137 S483P probably damaging Het
Arhgef10 T C 8: 14,975,093 probably null Het
Arhgef10 A G 8: 14,975,666 I459V probably benign Het
Armc2 C T 10: 41,966,700 probably null Het
Atp12a A G 14: 56,386,950 R952G possibly damaging Het
Atp6v1g1 A G 4: 63,550,021 Y87C probably benign Het
Col12a1 A T 9: 79,699,549 F531I probably damaging Het
Csmd2 T C 4: 128,557,718 F113S unknown Het
Ctnnd1 C T 2: 84,620,888 V123I possibly damaging Het
Cyp4a14 C A 4: 115,487,301 G456W probably damaging Het
Cyp4a30b A G 4: 115,458,362 H260R possibly damaging Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Het
Gpr156 T A 16: 37,992,223 V307D probably damaging Het
Gpr35 G A 1: 92,983,126 V187I probably benign Het
Gria2 G A 3: 80,702,492 T670I probably damaging Het
Hdac10 G T 15: 89,125,856 Q300K possibly damaging Het
Hdhd2 T C 18: 76,955,006 F44L probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hmcn1 A T 1: 150,738,716 V1313D possibly damaging Het
Ick A T 9: 78,140,100 probably null Het
Ift172 C T 5: 31,257,861 V1335I probably benign Het
Igsf9b A G 9: 27,322,223 I340V probably benign Het
Kif1c A G 11: 70,724,081 E567G probably damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Het
Matr3 T A 18: 35,572,296 S91R probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mtor T A 4: 148,540,030 M2089K probably benign Het
Myo9b T C 8: 71,290,966 Y224H probably benign Het
Nlrc3 T C 16: 3,957,326 D774G possibly damaging Het
Notum A G 11: 120,660,196 V48A probably benign Het
Nox3 T C 17: 3,682,916 H240R probably damaging Het
Nsun2 A G 13: 69,629,682 T425A probably damaging Het
Olfr1510 T G 14: 52,410,861 T4P probably benign Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Olfr99 A G 17: 37,279,976 V148A possibly damaging Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Otud4 T A 8: 79,661,073 N300K possibly damaging Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Paqr5 A T 9: 61,968,779 probably null Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Pcdhga9 T A 18: 37,737,471 Y118N possibly damaging Het
Pkd1l2 C T 8: 117,038,164 V1332I probably benign Het
Plcl1 A T 1: 55,697,150 D550V probably benign Het
Plekhg1 T G 10: 3,963,982 S1235A probably benign Het
Plekhg5 T A 4: 152,107,503 C433S probably benign Het
Plin2 A G 4: 86,668,678 M1T probably null Het
Polg2 A G 11: 106,775,425 probably null Het
Ppp1r7 T A 1: 93,357,863 probably null Het
Prdx4 A G X: 155,340,464 V15A probably benign Het
Rapgef6 T A 11: 54,661,175 F956L probably damaging Het
Rasl12 A G 9: 65,408,323 N83S probably benign Het
Rel T C 11: 23,761,129 I13V probably benign Het
Reln C T 5: 22,049,791 V527I possibly damaging Het
Sel1l3 C T 5: 53,137,883 W792* probably null Het
Slc39a8 T A 3: 135,886,793 probably null Het
Slc6a9 T A 4: 117,849,381 M1K probably null Het
Smpdl3a T A 10: 57,802,530 F143Y possibly damaging Het
Spsb4 G T 9: 96,996,018 T84K probably damaging Het
Tbc1d8 A G 1: 39,405,317 F187S probably damaging Het
Tdpoz3 T A 3: 93,826,428 F137I probably benign Het
Tgm7 G A 2: 121,109,693 probably benign Het
Tnni3k C T 3: 154,938,750 probably null Het
Tpd52 A T 3: 9,003,406 Y16* probably null Het
Trpa1 A G 1: 14,887,620 C705R probably damaging Het
Ttn A G 2: 76,750,851 S23233P probably damaging Het
Uevld T C 7: 46,947,945 D154G probably null Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Zfp292 G A 4: 34,808,595 T1483M probably damaging Het
Other mutations in Olfr654
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01481:Olfr654 APN 7 104587860 missense probably damaging 1.00
IGL01677:Olfr654 APN 7 104588145 missense probably damaging 0.97
IGL01807:Olfr654 APN 7 104587884 missense probably damaging 1.00
IGL03113:Olfr654 APN 7 104588733 missense probably benign 0.01
R0504:Olfr654 UTSW 7 104588475 nonsense probably null
R0647:Olfr654 UTSW 7 104588115 missense probably damaging 1.00
R0941:Olfr654 UTSW 7 104588338 missense probably damaging 1.00
R0945:Olfr654 UTSW 7 104588672 missense probably damaging 1.00
R1423:Olfr654 UTSW 7 104588475 nonsense probably null
R1860:Olfr654 UTSW 7 104587905 missense probably damaging 0.98
R2872:Olfr654 UTSW 7 104588493 missense possibly damaging 0.87
R4082:Olfr654 UTSW 7 104588623 missense probably damaging 1.00
R4760:Olfr654 UTSW 7 104588489 missense probably benign 0.32
R4787:Olfr654 UTSW 7 104587960 missense probably benign
R4969:Olfr654 UTSW 7 104588523 missense probably damaging 1.00
R5186:Olfr654 UTSW 7 104588211 missense probably damaging 1.00
R5706:Olfr654 UTSW 7 104587890 missense probably benign 0.02
R6582:Olfr654 UTSW 7 104588011 missense probably damaging 1.00
R7076:Olfr654 UTSW 7 104588223 missense probably damaging 1.00
R7155:Olfr654 UTSW 7 104588557 missense possibly damaging 0.88
R7424:Olfr654 UTSW 7 104588700 missense probably damaging 1.00
R7559:Olfr654 UTSW 7 104587880 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGCCAATCGAGTCATCCC -3'
(R):5'- ATTTTGTCCCGAAATTCCTTGG -3'

Sequencing Primer
(F):5'- GAGTCATCCCCACCACCTACTG -3'
(R):5'- TAGGATTAAGCATTGGTGGTACAAG -3'
Posted On2014-12-04