Incidental Mutation 'R2872:Col12a1'
ID253912
Institutional Source Beutler Lab
Gene Symbol Col12a1
Ensembl Gene ENSMUSG00000032332
Gene Namecollagen, type XII, alpha 1
Synonyms
MMRRC Submission 040460-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.351) question?
Stock #R2872 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location79598991-79718831 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79699549 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 531 (F531I)
Ref Sequence ENSEMBL: ENSMUSP00000112604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071750] [ENSMUST00000121227]
Predicted Effect probably damaging
Transcript: ENSMUST00000071750
AA Change: F531I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071662
Gene: ENSMUSG00000032332
AA Change: F531I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FN3 25 103 2.29e-10 SMART
low complexity region 114 129 N/A INTRINSIC
VWA 138 317 4e-63 SMART
FN3 334 413 1.47e-8 SMART
VWA 438 617 2.41e-57 SMART
FN3 632 710 1.62e-10 SMART
FN3 723 801 2.91e-12 SMART
FN3 814 892 6.05e-10 SMART
FN3 905 984 2.74e-8 SMART
FN3 995 1074 1.24e-6 SMART
FN3 1087 1166 5.78e-7 SMART
VWA 1197 1376 2.02e-59 SMART
FN3 1385 1463 1.13e-9 SMART
FN3 1474 1554 1.07e-10 SMART
FN3 1566 1643 3.73e-10 SMART
FN3 1655 1734 2.94e-8 SMART
FN3 1755 1834 1.54e-11 SMART
FN3 1846 1924 1.45e-7 SMART
FN3 1936 2015 1.47e-8 SMART
FN3 2027 2106 1.21e-9 SMART
FN3 2118 2195 2.14e-10 SMART
FN3 2206 2285 3.85e-3 SMART
low complexity region 2292 2314 N/A INTRINSIC
VWA 2323 2503 2.61e-53 SMART
TSPN 2522 2714 1.13e-76 SMART
Pfam:Collagen 2747 2804 1.7e-8 PFAM
Pfam:Collagen 2802 2855 6.5e-9 PFAM
Pfam:Collagen 2844 2904 1.1e-9 PFAM
Pfam:Collagen 2939 2994 4.6e-8 PFAM
low complexity region 3011 3044 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121227
AA Change: F531I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112604
Gene: ENSMUSG00000032332
AA Change: F531I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FN3 25 103 2.29e-10 SMART
low complexity region 114 129 N/A INTRINSIC
VWA 138 317 4e-63 SMART
FN3 334 413 1.47e-8 SMART
VWA 438 617 2.41e-57 SMART
FN3 632 710 1.62e-10 SMART
FN3 723 801 2.91e-12 SMART
FN3 814 892 6.05e-10 SMART
FN3 905 984 2.74e-8 SMART
FN3 995 1074 1.24e-6 SMART
FN3 1087 1166 5.78e-7 SMART
VWA 1197 1376 2.02e-59 SMART
FN3 1385 1463 1.13e-9 SMART
FN3 1474 1554 1.07e-10 SMART
FN3 1566 1643 3.73e-10 SMART
FN3 1655 1734 2.94e-8 SMART
FN3 1755 1834 1.54e-11 SMART
FN3 1846 1924 1.45e-7 SMART
FN3 1936 2015 1.47e-8 SMART
FN3 2027 2106 1.21e-9 SMART
FN3 2118 2195 2.14e-10 SMART
FN3 2206 2285 3.85e-3 SMART
low complexity region 2292 2314 N/A INTRINSIC
VWA 2323 2503 2.61e-53 SMART
TSPN 2522 2714 1.13e-76 SMART
Pfam:Collagen 2747 2804 4.7e-9 PFAM
Pfam:Collagen 2802 2861 2.9e-9 PFAM
Pfam:Collagen 2838 2900 7.1e-8 PFAM
Pfam:Collagen 2935 2990 1.3e-8 PFAM
low complexity region 3007 3040 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150289
Meta Mutation Damage Score 0.0788 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.6%
  • 10x: 94.5%
  • 20x: 80.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the alpha chain of type XII collagen, a member of the FACIT (fibril-associated collagens with interrupted triple helices) collagen family. Type XII collagen is a homotrimer found in association with type I collagen, an association that is thought to modify the interactions between collagen I fibrils and the surrounding matrix. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial perinatal lethality, decreased body weight, shorter and slender long bones, altered vertebrae structure, kyphosis, decreased bone strength, and abnormalities in osteoblast differentiation and bone matrix formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,955,176 C811R possibly damaging Het
AI481877 A C 4: 59,093,850 L226R probably damaging Het
Ak8 T C 2: 28,742,720 I317T possibly damaging Het
Als2 A G 1: 59,211,137 S483P probably damaging Het
Arhgef10 T C 8: 14,975,093 probably null Het
Arhgef10 A G 8: 14,975,666 I459V probably benign Het
Armc2 C T 10: 41,966,700 probably null Het
Atp12a A G 14: 56,386,950 R952G possibly damaging Het
Atp6v1g1 A G 4: 63,550,021 Y87C probably benign Het
Csmd2 T C 4: 128,557,718 F113S unknown Het
Ctnnd1 C T 2: 84,620,888 V123I possibly damaging Het
Cyp4a14 C A 4: 115,487,301 G456W probably damaging Het
Cyp4a30b A G 4: 115,458,362 H260R possibly damaging Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Het
Gpr156 T A 16: 37,992,223 V307D probably damaging Het
Gpr35 G A 1: 92,983,126 V187I probably benign Het
Gria2 G A 3: 80,702,492 T670I probably damaging Het
Hdac10 G T 15: 89,125,856 Q300K possibly damaging Het
Hdhd2 T C 18: 76,955,006 F44L probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hmcn1 A T 1: 150,738,716 V1313D possibly damaging Het
Ick A T 9: 78,140,100 probably null Het
Ift172 C T 5: 31,257,861 V1335I probably benign Het
Igsf9b A G 9: 27,322,223 I340V probably benign Het
Kif1c A G 11: 70,724,081 E567G probably damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Het
Matr3 T A 18: 35,572,296 S91R probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mtor T A 4: 148,540,030 M2089K probably benign Het
Myo9b T C 8: 71,290,966 Y224H probably benign Het
Nlrc3 T C 16: 3,957,326 D774G possibly damaging Het
Notum A G 11: 120,660,196 V48A probably benign Het
Nox3 T C 17: 3,682,916 H240R probably damaging Het
Nsun2 A G 13: 69,629,682 T425A probably damaging Het
Olfr1510 T G 14: 52,410,861 T4P probably benign Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Olfr654 T C 7: 104,588,493 S230P possibly damaging Het
Olfr99 A G 17: 37,279,976 V148A possibly damaging Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Otud4 T A 8: 79,661,073 N300K possibly damaging Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Paqr5 A T 9: 61,968,779 probably null Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Pcdhga9 T A 18: 37,737,471 Y118N possibly damaging Het
Pkd1l2 C T 8: 117,038,164 V1332I probably benign Het
Plcl1 A T 1: 55,697,150 D550V probably benign Het
Plekhg1 T G 10: 3,963,982 S1235A probably benign Het
Plekhg5 T A 4: 152,107,503 C433S probably benign Het
Plin2 A G 4: 86,668,678 M1T probably null Het
Polg2 A G 11: 106,775,425 probably null Het
Ppp1r7 T A 1: 93,357,863 probably null Het
Prdx4 A G X: 155,340,464 V15A probably benign Het
Rapgef6 T A 11: 54,661,175 F956L probably damaging Het
Rasl12 A G 9: 65,408,323 N83S probably benign Het
Rel T C 11: 23,761,129 I13V probably benign Het
Reln C T 5: 22,049,791 V527I possibly damaging Het
Sel1l3 C T 5: 53,137,883 W792* probably null Het
Slc39a8 T A 3: 135,886,793 probably null Het
Slc6a9 T A 4: 117,849,381 M1K probably null Het
Smpdl3a T A 10: 57,802,530 F143Y possibly damaging Het
Spsb4 G T 9: 96,996,018 T84K probably damaging Het
Tbc1d8 A G 1: 39,405,317 F187S probably damaging Het
Tdpoz3 T A 3: 93,826,428 F137I probably benign Het
Tgm7 G A 2: 121,109,693 probably benign Het
Tnni3k C T 3: 154,938,750 probably null Het
Tpd52 A T 3: 9,003,406 Y16* probably null Het
Trpa1 A G 1: 14,887,620 C705R probably damaging Het
Ttn A G 2: 76,750,851 S23233P probably damaging Het
Uevld T C 7: 46,947,945 D154G probably null Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Zfp292 G A 4: 34,808,595 T1483M probably damaging Het
Other mutations in Col12a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Col12a1 APN 9 79681537 missense possibly damaging 0.55
IGL00434:Col12a1 APN 9 79653332 missense probably benign 0.27
IGL00465:Col12a1 APN 9 79697581 missense probably damaging 1.00
IGL00568:Col12a1 APN 9 79651477 missense probably damaging 1.00
IGL00576:Col12a1 APN 9 79647652 missense probably damaging 1.00
IGL00580:Col12a1 APN 9 79692226 missense probably benign 0.05
IGL01015:Col12a1 APN 9 79633741 missense probably damaging 1.00
IGL01124:Col12a1 APN 9 79703847 missense probably damaging 1.00
IGL01138:Col12a1 APN 9 79678053 missense probably damaging 1.00
IGL01295:Col12a1 APN 9 79643926 missense probably damaging 1.00
IGL01630:Col12a1 APN 9 79657366 missense probably damaging 1.00
IGL01648:Col12a1 APN 9 79601169 makesense probably null
IGL01878:Col12a1 APN 9 79649975 missense possibly damaging 0.72
IGL01921:Col12a1 APN 9 79650017 missense possibly damaging 0.50
IGL02064:Col12a1 APN 9 79692372 missense probably benign 0.06
IGL02123:Col12a1 APN 9 79662458 critical splice donor site probably null
IGL02312:Col12a1 APN 9 79681515 missense probably damaging 1.00
IGL02320:Col12a1 APN 9 79616021 critical splice donor site probably null
IGL02328:Col12a1 APN 9 79682066 missense probably damaging 1.00
IGL02342:Col12a1 APN 9 79649896 splice site probably null
IGL02355:Col12a1 APN 9 79630711 splice site probably benign
IGL02362:Col12a1 APN 9 79630711 splice site probably benign
IGL02396:Col12a1 APN 9 79662583 missense probably benign
IGL02449:Col12a1 APN 9 79641469 missense probably damaging 1.00
IGL02682:Col12a1 APN 9 79699341 missense probably damaging 1.00
IGL02751:Col12a1 APN 9 79613859 unclassified probably benign
IGL02801:Col12a1 APN 9 79608414 splice site probably null
IGL03001:Col12a1 APN 9 79633673 missense probably damaging 1.00
IGL03027:Col12a1 APN 9 79641551 missense probably benign 0.40
IGL03090:Col12a1 APN 9 79678370 missense probably damaging 1.00
IGL03115:Col12a1 APN 9 79681437 missense probably damaging 1.00
IGL03220:Col12a1 APN 9 79699483 missense probably damaging 1.00
IGL03240:Col12a1 APN 9 79678383 splice site probably null
IGL03348:Col12a1 APN 9 79693430 missense possibly damaging 0.88
hardly UTSW 9 79700350 nonsense probably null
P0045:Col12a1 UTSW 9 79647611 missense probably damaging 0.99
R0015:Col12a1 UTSW 9 79651385 missense probably damaging 1.00
R0015:Col12a1 UTSW 9 79651385 missense probably damaging 1.00
R0240:Col12a1 UTSW 9 79652033 missense probably benign 0.02
R0276:Col12a1 UTSW 9 79630741 nonsense probably null
R0309:Col12a1 UTSW 9 79600011 unclassified probably null
R0336:Col12a1 UTSW 9 79702345 missense probably damaging 0.98
R0376:Col12a1 UTSW 9 79693494 missense probably benign 0.10
R0413:Col12a1 UTSW 9 79699360 missense probably damaging 0.99
R0504:Col12a1 UTSW 9 79681468 missense possibly damaging 0.90
R0542:Col12a1 UTSW 9 79605328 critical splice donor site probably null
R0610:Col12a1 UTSW 9 79707848 missense probably benign
R0631:Col12a1 UTSW 9 79703376 missense probably damaging 1.00
R0637:Col12a1 UTSW 9 79656735 missense probably benign 0.00
R0667:Col12a1 UTSW 9 79628462 missense probably damaging 1.00
R0711:Col12a1 UTSW 9 79652035 missense probably damaging 1.00
R0717:Col12a1 UTSW 9 79612419 missense probably damaging 1.00
R0762:Col12a1 UTSW 9 79681374 splice site probably benign
R0787:Col12a1 UTSW 9 79638485 missense probably damaging 0.99
R0890:Col12a1 UTSW 9 79700402 missense probably damaging 0.97
R0900:Col12a1 UTSW 9 79684253 missense possibly damaging 0.91
R1109:Col12a1 UTSW 9 79699723 missense probably damaging 1.00
R1264:Col12a1 UTSW 9 79620089 missense probably benign 0.09
R1321:Col12a1 UTSW 9 79617709 nonsense probably null
R1344:Col12a1 UTSW 9 79699555 nonsense probably null
R1387:Col12a1 UTSW 9 79681375 splice site probably benign
R1511:Col12a1 UTSW 9 79699552 missense probably benign 0.02
R1523:Col12a1 UTSW 9 79660996 missense probably benign 0.01
R1526:Col12a1 UTSW 9 79656798 missense probably benign 0.44
R1564:Col12a1 UTSW 9 79613840 missense probably damaging 1.00
R1595:Col12a1 UTSW 9 79602254 missense probably damaging 1.00
R1603:Col12a1 UTSW 9 79612962 missense probably damaging 1.00
R1673:Col12a1 UTSW 9 79693538 missense probably benign 0.00
R1730:Col12a1 UTSW 9 79628378 missense possibly damaging 0.93
R1737:Col12a1 UTSW 9 79703451 missense probably damaging 1.00
R1739:Col12a1 UTSW 9 79633468 missense probably damaging 0.98
R1748:Col12a1 UTSW 9 79672997 missense probably benign 0.01
R1778:Col12a1 UTSW 9 79604585 splice site probably benign
R1845:Col12a1 UTSW 9 79697541 missense probably benign 0.09
R1864:Col12a1 UTSW 9 79627103 splice site probably null
R1876:Col12a1 UTSW 9 79678281 nonsense probably null
R1934:Col12a1 UTSW 9 79604522 nonsense probably null
R1942:Col12a1 UTSW 9 79635466 missense probably damaging 1.00
R1950:Col12a1 UTSW 9 79630549 missense possibly damaging 0.62
R2027:Col12a1 UTSW 9 79645793 critical splice acceptor site probably null
R2061:Col12a1 UTSW 9 79617705 missense possibly damaging 0.88
R2064:Col12a1 UTSW 9 79662454 splice site probably benign
R2070:Col12a1 UTSW 9 79647696 missense probably benign 0.00
R2112:Col12a1 UTSW 9 79643899 missense possibly damaging 0.93
R2209:Col12a1 UTSW 9 79692352 missense possibly damaging 0.83
R2275:Col12a1 UTSW 9 79635427 missense probably damaging 0.99
R2330:Col12a1 UTSW 9 79633657 missense probably damaging 0.99
R2373:Col12a1 UTSW 9 79656813 missense probably benign 0.03
R2425:Col12a1 UTSW 9 79678366 missense probably damaging 1.00
R2428:Col12a1 UTSW 9 79602251 missense probably benign 0.30
R2437:Col12a1 UTSW 9 79692219 missense probably damaging 0.97
R2831:Col12a1 UTSW 9 79697401 missense probably null 0.99
R2851:Col12a1 UTSW 9 79678332 missense probably damaging 1.00
R2872:Col12a1 UTSW 9 79699549 missense probably damaging 1.00
R2874:Col12a1 UTSW 9 79699549 missense probably damaging 1.00
R2904:Col12a1 UTSW 9 79652025 missense probably damaging 1.00
R2905:Col12a1 UTSW 9 79652025 missense probably damaging 1.00
R2991:Col12a1 UTSW 9 79700265 missense probably damaging 1.00
R3402:Col12a1 UTSW 9 79643947 missense probably damaging 1.00
R3429:Col12a1 UTSW 9 79680311 missense probably benign
R3430:Col12a1 UTSW 9 79680311 missense probably benign
R3547:Col12a1 UTSW 9 79633416 missense probably damaging 1.00
R3789:Col12a1 UTSW 9 79639723 missense possibly damaging 0.96
R4091:Col12a1 UTSW 9 79702364 missense probably damaging 0.99
R4328:Col12a1 UTSW 9 79700389 missense possibly damaging 0.91
R4382:Col12a1 UTSW 9 79630741 nonsense probably null
R4392:Col12a1 UTSW 9 79662488 missense probably damaging 1.00
R4405:Col12a1 UTSW 9 79639965 critical splice donor site probably null
R4465:Col12a1 UTSW 9 79672910 missense possibly damaging 0.62
R4521:Col12a1 UTSW 9 79633357 missense probably benign 0.00
R4612:Col12a1 UTSW 9 79616057 missense probably damaging 0.99
R4613:Col12a1 UTSW 9 79647601 missense probably benign 0.03
R4649:Col12a1 UTSW 9 79639794 missense probably damaging 1.00
R4651:Col12a1 UTSW 9 79612946 missense probably damaging 1.00
R4652:Col12a1 UTSW 9 79612946 missense probably damaging 1.00
R4738:Col12a1 UTSW 9 79699282 missense probably damaging 1.00
R4745:Col12a1 UTSW 9 79652086 splice site probably null
R4761:Col12a1 UTSW 9 79657310 missense probably benign 0.34
R4784:Col12a1 UTSW 9 79678494 missense possibly damaging 0.50
R4785:Col12a1 UTSW 9 79678494 missense possibly damaging 0.50
R4809:Col12a1 UTSW 9 79693567 missense probably benign 0.10
R4821:Col12a1 UTSW 9 79715340 intron probably benign
R4925:Col12a1 UTSW 9 79674795 missense probably damaging 1.00
R4938:Col12a1 UTSW 9 79700350 nonsense probably null
R5034:Col12a1 UTSW 9 79657367 missense probably damaging 1.00
R5133:Col12a1 UTSW 9 79605174 missense probably damaging 0.99
R5138:Col12a1 UTSW 9 79643966 missense probably damaging 1.00
R5145:Col12a1 UTSW 9 79706300 missense probably benign 0.00
R5152:Col12a1 UTSW 9 79656748 missense probably damaging 1.00
R5237:Col12a1 UTSW 9 79700262 missense probably benign 0.00
R5268:Col12a1 UTSW 9 79678047 missense probably damaging 0.99
R5328:Col12a1 UTSW 9 79620060 missense probably damaging 0.96
R5372:Col12a1 UTSW 9 79678366 missense probably damaging 1.00
R5440:Col12a1 UTSW 9 79614363 missense probably benign 0.07
R5496:Col12a1 UTSW 9 79602185 splice site probably benign
R5537:Col12a1 UTSW 9 79699590 missense probably damaging 1.00
R5596:Col12a1 UTSW 9 79703759 missense probably damaging 1.00
R5677:Col12a1 UTSW 9 79699321 missense probably damaging 1.00
R5715:Col12a1 UTSW 9 79616065 nonsense probably null
R5796:Col12a1 UTSW 9 79703829 missense possibly damaging 0.73
R5829:Col12a1 UTSW 9 79633673 missense probably damaging 1.00
R5865:Col12a1 UTSW 9 79604478 missense probably benign 0.00
R5919:Col12a1 UTSW 9 79602298 missense probably damaging 0.99
R5974:Col12a1 UTSW 9 79682127 missense probably damaging 0.99
R5981:Col12a1 UTSW 9 79678506 missense probably damaging 0.99
R5982:Col12a1 UTSW 9 79630560 missense probably damaging 1.00
R6027:Col12a1 UTSW 9 79656578 critical splice donor site probably null
R6090:Col12a1 UTSW 9 79692393 missense probably damaging 1.00
R6293:Col12a1 UTSW 9 79614358 missense probably benign 0.00
R6393:Col12a1 UTSW 9 79655485 missense probably damaging 0.99
R6457:Col12a1 UTSW 9 79645691 missense probably damaging 1.00
R6505:Col12a1 UTSW 9 79647605 missense probably damaging 0.98
R6508:Col12a1 UTSW 9 79649949 missense probably damaging 1.00
R6620:Col12a1 UTSW 9 79620049 missense probably damaging 0.98
R6718:Col12a1 UTSW 9 79699605 missense probably damaging 1.00
R6752:Col12a1 UTSW 9 79633424 missense possibly damaging 0.72
R6774:Col12a1 UTSW 9 79706337 missense possibly damaging 0.65
R6872:Col12a1 UTSW 9 79677234 missense probably damaging 1.00
R6884:Col12a1 UTSW 9 79639809 missense possibly damaging 0.92
R6935:Col12a1 UTSW 9 79700500 missense possibly damaging 0.76
X0021:Col12a1 UTSW 9 79608485 missense probably damaging 1.00
X0058:Col12a1 UTSW 9 79602224 missense possibly damaging 0.66
X0061:Col12a1 UTSW 9 79612392 splice site probably null
Predicted Primers PCR Primer
(F):5'- AATCCTCCACTGTGAACACGTG -3'
(R):5'- AGTTTTGAGATTTCTCCGAACAGG -3'

Sequencing Primer
(F):5'- ACTGTGAACACGTGGGTCTCAG -3'
(R):5'- ATTTCTCCGAACAGGGTGCAG -3'
Posted On2014-12-04