Incidental Mutation 'R2872:Polg2'
ID253930
Institutional Source Beutler Lab
Gene Symbol Polg2
Ensembl Gene ENSMUSG00000020718
Gene Namepolymerase (DNA directed), gamma 2, accessory subunit
Synonyms
MMRRC Submission 040460-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2872 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location106768253-106779537 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 106775425 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021060 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021060] [ENSMUST00000021062] [ENSMUST00000126201] [ENSMUST00000127061] [ENSMUST00000134029] [ENSMUST00000155107]
PDB Structure
CRYSTAL STRUCTURE OF THE ACCESSORY SUBUNIT OF MURINE MITOCHONDRIAL POLYMERASE GAMMA [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE ACCESSORY SUBUNIT OF MURINE MITOCHONDRIAL POLYMERASE GAMMA [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000021060
SMART Domains Protein: ENSMUSP00000021060
Gene: ENSMUSG00000020718

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
SCOP:d1g5ha2 41 330 4e-36 SMART
Pfam:HGTP_anticodon 354 452 3e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000021062
SMART Domains Protein: ENSMUSP00000021062
Gene: ENSMUSG00000020719

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
Blast:DEXDc 24 86 9e-31 BLAST
DEXDc 113 316 7.67e-64 SMART
HELICc 355 436 3.57e-32 SMART
low complexity region 477 496 N/A INTRINSIC
Pfam:P68HR 498 532 8e-20 PFAM
Pfam:P68HR 551 583 5.2e-20 PFAM
low complexity region 592 603 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126201
SMART Domains Protein: ENSMUSP00000116583
Gene: ENSMUSG00000020718

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDB:1G5I|D 17 134 2e-70 PDB
SCOP:d1g5ha2 41 130 8e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127061
SMART Domains Protein: ENSMUSP00000117441
Gene: ENSMUSG00000020718

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDB:1G5I|D 17 170 1e-100 PDB
SCOP:d1g5ha2 41 163 1e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000134029
SMART Domains Protein: ENSMUSP00000122755
Gene: ENSMUSG00000020718

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDB:1G5I|D 17 122 3e-69 PDB
SCOP:d1g5ha2 41 120 3e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142590
Predicted Effect probably benign
Transcript: ENSMUST00000155107
SMART Domains Protein: ENSMUSP00000118975
Gene: ENSMUSG00000020718

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
PDB:1G5I|D 17 122 3e-69 PDB
SCOP:d1g5ha2 41 120 3e-6 SMART
Meta Mutation Damage Score 0.446 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.6%
  • 10x: 94.5%
  • 20x: 80.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the processivity subunit of the mitochondrial DNA polymerase gamma. The encoded protein forms a heterotrimer containing one catalytic subunit and two processivity subunits. This protein enhances DNA binding and promotes processive DNA synthesis. Mutations in this gene result in autosomal dominant progressive external ophthalmoplegia with mitochondrial DNA deletions.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between somite formation and turning, fail to initiate turning, lack mt-Co1 activity, and contain abnormal mitochondria with reduced mtDNA. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,955,176 C811R possibly damaging Het
AI481877 A C 4: 59,093,850 L226R probably damaging Het
Ak8 T C 2: 28,742,720 I317T possibly damaging Het
Als2 A G 1: 59,211,137 S483P probably damaging Het
Arhgef10 T C 8: 14,975,093 probably null Het
Arhgef10 A G 8: 14,975,666 I459V probably benign Het
Armc2 C T 10: 41,966,700 probably null Het
Atp12a A G 14: 56,386,950 R952G possibly damaging Het
Atp6v1g1 A G 4: 63,550,021 Y87C probably benign Het
Col12a1 A T 9: 79,699,549 F531I probably damaging Het
Csmd2 T C 4: 128,557,718 F113S unknown Het
Ctnnd1 C T 2: 84,620,888 V123I possibly damaging Het
Cyp4a14 C A 4: 115,487,301 G456W probably damaging Het
Cyp4a30b A G 4: 115,458,362 H260R possibly damaging Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Het
Gpr156 T A 16: 37,992,223 V307D probably damaging Het
Gpr35 G A 1: 92,983,126 V187I probably benign Het
Gria2 G A 3: 80,702,492 T670I probably damaging Het
Hdac10 G T 15: 89,125,856 Q300K possibly damaging Het
Hdhd2 T C 18: 76,955,006 F44L probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hmcn1 A T 1: 150,738,716 V1313D possibly damaging Het
Ick A T 9: 78,140,100 probably null Het
Ift172 C T 5: 31,257,861 V1335I probably benign Het
Igsf9b A G 9: 27,322,223 I340V probably benign Het
Kif1c A G 11: 70,724,081 E567G probably damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Het
Matr3 T A 18: 35,572,296 S91R probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mtor T A 4: 148,540,030 M2089K probably benign Het
Myo9b T C 8: 71,290,966 Y224H probably benign Het
Nlrc3 T C 16: 3,957,326 D774G possibly damaging Het
Notum A G 11: 120,660,196 V48A probably benign Het
Nox3 T C 17: 3,682,916 H240R probably damaging Het
Nsun2 A G 13: 69,629,682 T425A probably damaging Het
Olfr1510 T G 14: 52,410,861 T4P probably benign Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Olfr654 T C 7: 104,588,493 S230P possibly damaging Het
Olfr99 A G 17: 37,279,976 V148A possibly damaging Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Otud4 T A 8: 79,661,073 N300K possibly damaging Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Paqr5 A T 9: 61,968,779 probably null Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Pcdhga9 T A 18: 37,737,471 Y118N possibly damaging Het
Pkd1l2 C T 8: 117,038,164 V1332I probably benign Het
Plcl1 A T 1: 55,697,150 D550V probably benign Het
Plekhg1 T G 10: 3,963,982 S1235A probably benign Het
Plekhg5 T A 4: 152,107,503 C433S probably benign Het
Plin2 A G 4: 86,668,678 M1T probably null Het
Ppp1r7 T A 1: 93,357,863 probably null Het
Prdx4 A G X: 155,340,464 V15A probably benign Het
Rapgef6 T A 11: 54,661,175 F956L probably damaging Het
Rasl12 A G 9: 65,408,323 N83S probably benign Het
Rel T C 11: 23,761,129 I13V probably benign Het
Reln C T 5: 22,049,791 V527I possibly damaging Het
Sel1l3 C T 5: 53,137,883 W792* probably null Het
Slc39a8 T A 3: 135,886,793 probably null Het
Slc6a9 T A 4: 117,849,381 M1K probably null Het
Smpdl3a T A 10: 57,802,530 F143Y possibly damaging Het
Spsb4 G T 9: 96,996,018 T84K probably damaging Het
Tbc1d8 A G 1: 39,405,317 F187S probably damaging Het
Tdpoz3 T A 3: 93,826,428 F137I probably benign Het
Tgm7 G A 2: 121,109,693 probably benign Het
Tnni3k C T 3: 154,938,750 probably null Het
Tpd52 A T 3: 9,003,406 Y16* probably null Het
Trpa1 A G 1: 14,887,620 C705R probably damaging Het
Ttn A G 2: 76,750,851 S23233P probably damaging Het
Uevld T C 7: 46,947,945 D154G probably null Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Zfp292 G A 4: 34,808,595 T1483M probably damaging Het
Other mutations in Polg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01150:Polg2 APN 11 106777432 splice site probably null
IGL02205:Polg2 APN 11 106779120 missense probably benign 0.09
IGL02850:Polg2 APN 11 106768467 missense probably damaging 1.00
IGL02952:Polg2 APN 11 106772713 missense possibly damaging 0.78
IGL03328:Polg2 APN 11 106768337 missense probably benign 0.40
IGL02835:Polg2 UTSW 11 106775440 missense probably benign
R0109:Polg2 UTSW 11 106777132 splice site probably benign
R0143:Polg2 UTSW 11 106777526 missense probably benign 0.01
R0709:Polg2 UTSW 11 106768413 missense probably damaging 1.00
R1385:Polg2 UTSW 11 106768323 missense probably damaging 0.97
R1938:Polg2 UTSW 11 106778961 missense probably damaging 0.98
R2872:Polg2 UTSW 11 106775425 critical splice donor site probably null
R3159:Polg2 UTSW 11 106768337 missense probably benign 0.40
R3776:Polg2 UTSW 11 106779284 missense probably benign 0.01
R3982:Polg2 UTSW 11 106779202 nonsense probably null
R5306:Polg2 UTSW 11 106778970 missense probably damaging 0.98
R5338:Polg2 UTSW 11 106779238 missense possibly damaging 0.95
R7055:Polg2 UTSW 11 106777214 missense probably damaging 1.00
R7146:Polg2 UTSW 11 106772746 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TATTCAATTCCATCTCCTGGGG -3'
(R):5'- TGCAGTTTGCTATGAGTCCC -3'

Sequencing Primer
(F):5'- GATGATCACGGTGGGTCAC -3'
(R):5'- GAGTCCCTCTAACTTCAGCAGCG -3'
Posted On2014-12-04