Incidental Mutation 'R2872:Abca8b'
ID253933
Institutional Source Beutler Lab
Gene Symbol Abca8b
Ensembl Gene ENSMUSG00000020620
Gene NameATP-binding cassette, sub-family A (ABC1), member 8b
SynonymsAbca8
MMRRC Submission 040460-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2872 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location109932190-109995845 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 109955176 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 811 (C811R)
Ref Sequence ENSEMBL: ENSMUSP00000102280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020948] [ENSMUST00000106669]
Predicted Effect probably benign
Transcript: ENSMUST00000020948
AA Change: C873R

PolyPhen 2 Score 0.332 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000020948
Gene: ENSMUSG00000020620
AA Change: C873R

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 417 3.9e-28 PFAM
AAA 507 691 6.36e-10 SMART
Pfam:ABC2_membrane_3 859 1215 1e-10 PFAM
low complexity region 1246 1255 N/A INTRINSIC
AAA 1313 1492 6.17e-8 SMART
low complexity region 1597 1607 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106669
AA Change: C811R

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102280
Gene: ENSMUSG00000020620
AA Change: C811R

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 344 2.6e-16 PFAM
AAA 445 629 6.36e-10 SMART
transmembrane domain 798 815 N/A INTRINSIC
transmembrane domain 1001 1023 N/A INTRINSIC
transmembrane domain 1038 1060 N/A INTRINSIC
transmembrane domain 1072 1091 N/A INTRINSIC
transmembrane domain 1101 1123 N/A INTRINSIC
transmembrane domain 1136 1158 N/A INTRINSIC
low complexity region 1184 1193 N/A INTRINSIC
AAA 1251 1430 6.17e-8 SMART
low complexity region 1535 1545 N/A INTRINSIC
Meta Mutation Damage Score 0.182 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.6%
  • 10x: 94.5%
  • 20x: 80.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. The encoded protein may regulate lipid metabolism and be involved in the formation and maintenance of myelin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI481877 A C 4: 59,093,850 L226R probably damaging Het
Ak8 T C 2: 28,742,720 I317T possibly damaging Het
Als2 A G 1: 59,211,137 S483P probably damaging Het
Arhgef10 T C 8: 14,975,093 probably null Het
Arhgef10 A G 8: 14,975,666 I459V probably benign Het
Armc2 C T 10: 41,966,700 probably null Het
Atp12a A G 14: 56,386,950 R952G possibly damaging Het
Atp6v1g1 A G 4: 63,550,021 Y87C probably benign Het
Col12a1 A T 9: 79,699,549 F531I probably damaging Het
Csmd2 T C 4: 128,557,718 F113S unknown Het
Ctnnd1 C T 2: 84,620,888 V123I possibly damaging Het
Cyp4a14 C A 4: 115,487,301 G456W probably damaging Het
Cyp4a30b A G 4: 115,458,362 H260R possibly damaging Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Het
Gpr156 T A 16: 37,992,223 V307D probably damaging Het
Gpr35 G A 1: 92,983,126 V187I probably benign Het
Gria2 G A 3: 80,702,492 T670I probably damaging Het
Hdac10 G T 15: 89,125,856 Q300K possibly damaging Het
Hdhd2 T C 18: 76,955,006 F44L probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hmcn1 A T 1: 150,738,716 V1313D possibly damaging Het
Ick A T 9: 78,140,100 probably null Het
Ift172 C T 5: 31,257,861 V1335I probably benign Het
Igsf9b A G 9: 27,322,223 I340V probably benign Het
Kif1c A G 11: 70,724,081 E567G probably damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Het
Matr3 T A 18: 35,572,296 S91R probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mtor T A 4: 148,540,030 M2089K probably benign Het
Myo9b T C 8: 71,290,966 Y224H probably benign Het
Nlrc3 T C 16: 3,957,326 D774G possibly damaging Het
Notum A G 11: 120,660,196 V48A probably benign Het
Nox3 T C 17: 3,682,916 H240R probably damaging Het
Nsun2 A G 13: 69,629,682 T425A probably damaging Het
Olfr1510 T G 14: 52,410,861 T4P probably benign Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Olfr654 T C 7: 104,588,493 S230P possibly damaging Het
Olfr99 A G 17: 37,279,976 V148A possibly damaging Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Otud4 T A 8: 79,661,073 N300K possibly damaging Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Paqr5 A T 9: 61,968,779 probably null Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Pcdhga9 T A 18: 37,737,471 Y118N possibly damaging Het
Pkd1l2 C T 8: 117,038,164 V1332I probably benign Het
Plcl1 A T 1: 55,697,150 D550V probably benign Het
Plekhg1 T G 10: 3,963,982 S1235A probably benign Het
Plekhg5 T A 4: 152,107,503 C433S probably benign Het
Plin2 A G 4: 86,668,678 M1T probably null Het
Polg2 A G 11: 106,775,425 probably null Het
Ppp1r7 T A 1: 93,357,863 probably null Het
Prdx4 A G X: 155,340,464 V15A probably benign Het
Rapgef6 T A 11: 54,661,175 F956L probably damaging Het
Rasl12 A G 9: 65,408,323 N83S probably benign Het
Rel T C 11: 23,761,129 I13V probably benign Het
Reln C T 5: 22,049,791 V527I possibly damaging Het
Sel1l3 C T 5: 53,137,883 W792* probably null Het
Slc39a8 T A 3: 135,886,793 probably null Het
Slc6a9 T A 4: 117,849,381 M1K probably null Het
Smpdl3a T A 10: 57,802,530 F143Y possibly damaging Het
Spsb4 G T 9: 96,996,018 T84K probably damaging Het
Tbc1d8 A G 1: 39,405,317 F187S probably damaging Het
Tdpoz3 T A 3: 93,826,428 F137I probably benign Het
Tgm7 G A 2: 121,109,693 probably benign Het
Tnni3k C T 3: 154,938,750 probably null Het
Tpd52 A T 3: 9,003,406 Y16* probably null Het
Trpa1 A G 1: 14,887,620 C705R probably damaging Het
Ttn A G 2: 76,750,851 S23233P probably damaging Het
Uevld T C 7: 46,947,945 D154G probably null Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Zfp292 G A 4: 34,808,595 T1483M probably damaging Het
Other mutations in Abca8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00862:Abca8b APN 11 109953548 missense possibly damaging 0.66
IGL00952:Abca8b APN 11 109969060 critical splice donor site probably null
IGL01141:Abca8b APN 11 109937730 missense probably damaging 1.00
IGL01523:Abca8b APN 11 109976494 missense probably damaging 1.00
IGL01633:Abca8b APN 11 109936754 missense probably damaging 0.99
IGL01862:Abca8b APN 11 109947171 nonsense probably null
IGL01963:Abca8b APN 11 109971763 missense probably damaging 0.99
IGL02169:Abca8b APN 11 109952582 missense probably damaging 0.98
IGL02536:Abca8b APN 11 109981748 missense probably benign 0.02
IGL02658:Abca8b APN 11 109952560 missense probably benign
IGL02828:Abca8b APN 11 109980894 missense probably damaging 0.99
IGL03118:Abca8b APN 11 109947181 missense possibly damaging 0.66
IGL03302:Abca8b APN 11 109967750 missense possibly damaging 0.80
IGL03325:Abca8b APN 11 109953596 missense possibly damaging 0.94
R0057:Abca8b UTSW 11 109941559 missense possibly damaging 0.91
R0131:Abca8b UTSW 11 109942289 missense possibly damaging 0.46
R0226:Abca8b UTSW 11 109957018 intron probably null
R0426:Abca8b UTSW 11 109955027 splice site probably benign
R0432:Abca8b UTSW 11 109980015 missense possibly damaging 0.94
R0512:Abca8b UTSW 11 109950650 missense probably benign 0.32
R0589:Abca8b UTSW 11 109942268 missense probably damaging 0.96
R0690:Abca8b UTSW 11 109969808 splice site probably benign
R1263:Abca8b UTSW 11 109941607 missense possibly damaging 0.66
R1371:Abca8b UTSW 11 109953553 missense probably damaging 0.99
R1497:Abca8b UTSW 11 109973821 splice site probably benign
R1502:Abca8b UTSW 11 109974645 missense probably damaging 1.00
R1517:Abca8b UTSW 11 109971814 missense possibly damaging 0.66
R1543:Abca8b UTSW 11 109974674 missense probably damaging 0.98
R1618:Abca8b UTSW 11 109949888 splice site probably benign
R1625:Abca8b UTSW 11 109967121 missense probably benign 0.11
R1753:Abca8b UTSW 11 109973716 missense probably benign 0.00
R1819:Abca8b UTSW 11 109981056 critical splice acceptor site probably null
R1822:Abca8b UTSW 11 109957075 missense possibly damaging 0.92
R1829:Abca8b UTSW 11 109942341 missense probably damaging 0.97
R1873:Abca8b UTSW 11 109979955 missense probably benign 0.01
R1899:Abca8b UTSW 11 109937918 missense possibly damaging 0.92
R1908:Abca8b UTSW 11 109957098 missense possibly damaging 0.92
R1962:Abca8b UTSW 11 109979898 missense probably benign 0.00
R1984:Abca8b UTSW 11 109977841 missense probably damaging 1.00
R2035:Abca8b UTSW 11 109957106 missense possibly damaging 0.94
R2092:Abca8b UTSW 11 109966708 missense possibly damaging 0.63
R2100:Abca8b UTSW 11 109937782 missense probably damaging 1.00
R2267:Abca8b UTSW 11 109955148 missense probably benign 0.03
R2871:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2871:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2872:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2873:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R3711:Abca8b UTSW 11 109946255 missense possibly damaging 0.46
R3937:Abca8b UTSW 11 109974567 missense probably benign 0.01
R4052:Abca8b UTSW 11 109981725 nonsense probably null
R4060:Abca8b UTSW 11 109957201 missense probably benign 0.04
R4207:Abca8b UTSW 11 109981725 nonsense probably null
R4208:Abca8b UTSW 11 109981725 nonsense probably null
R4354:Abca8b UTSW 11 109971692 missense probably benign 0.27
R4399:Abca8b UTSW 11 109936385 missense possibly damaging 0.66
R4456:Abca8b UTSW 11 109942245 missense probably benign 0.27
R4509:Abca8b UTSW 11 109966755 missense probably damaging 1.00
R4672:Abca8b UTSW 11 109936448 missense possibly damaging 0.81
R4868:Abca8b UTSW 11 109974512 missense probably benign 0.05
R5002:Abca8b UTSW 11 109961797 missense probably damaging 0.96
R5007:Abca8b UTSW 11 109936764 missense probably damaging 1.00
R5014:Abca8b UTSW 11 109950131 missense probably damaging 0.98
R5023:Abca8b UTSW 11 109974988 critical splice donor site probably null
R5091:Abca8b UTSW 11 109936384 missense possibly damaging 0.92
R5098:Abca8b UTSW 11 109957118 missense probably benign 0.05
R5117:Abca8b UTSW 11 109966803 missense probably damaging 1.00
R5234:Abca8b UTSW 11 109976594 missense possibly damaging 0.90
R5302:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5307:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5487:Abca8b UTSW 11 109953514 missense probably damaging 0.99
R5512:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5564:Abca8b UTSW 11 109934581 missense probably benign 0.08
R5610:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5677:Abca8b UTSW 11 109940861 missense probably damaging 1.00
R5723:Abca8b UTSW 11 109953619 missense possibly damaging 0.90
R5827:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5829:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5848:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5849:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5850:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5854:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5982:Abca8b UTSW 11 109953597 missense possibly damaging 0.80
R5994:Abca8b UTSW 11 109949766 splice site probably null
R6035:Abca8b UTSW 11 109971860 splice site probably null
R6035:Abca8b UTSW 11 109971860 splice site probably null
R6050:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R6145:Abca8b UTSW 11 109973808 missense probably benign 0.03
R6223:Abca8b UTSW 11 109977846 missense probably benign 0.00
R6349:Abca8b UTSW 11 109934718 splice site probably null
R7002:Abca8b UTSW 11 109941564 missense probably damaging 1.00
R7050:Abca8b UTSW 11 109973718 missense possibly damaging 0.90
R7107:Abca8b UTSW 11 109976473 missense probably damaging 0.98
R7158:Abca8b UTSW 11 109934589 missense probably damaging 1.00
R7170:Abca8b UTSW 11 109945828 missense probably benign 0.09
R7197:Abca8b UTSW 11 109945822 nonsense probably null
R7220:Abca8b UTSW 11 109981717 missense probably damaging 1.00
Z1088:Abca8b UTSW 11 109976482 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- TGCCCAGCACTTTCAGAATG -3'
(R):5'- TCCCCTCAAATTTAGAAGTGAGAGAG -3'

Sequencing Primer
(F):5'- CCAGCACTTTCAGAATGAAACATAG -3'
(R):5'- CACATGGTGGCTCATGACTATCTAG -3'
Posted On2014-12-04