Incidental Mutation 'R2872:Notum'
ID253935
Institutional Source Beutler Lab
Gene Symbol Notum
Ensembl Gene ENSMUSG00000042988
Gene Namenotum palmitoleoyl-protein carboxylesterase
Synonyms
MMRRC Submission 040460-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.792) question?
Stock #R2872 (G1)
Quality Score106
Status Not validated
Chromosome11
Chromosomal Location120653788-120661175 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120660196 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 48 (V48A)
Ref Sequence ENSEMBL: ENSMUSP00000122788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106177] [ENSMUST00000106178] [ENSMUST00000150458]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000055439
Predicted Effect probably benign
Transcript: ENSMUST00000106177
AA Change: V48A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101783
Gene: ENSMUSG00000042988
AA Change: V48A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
Pfam:PAE 78 431 6.2e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106178
AA Change: V48A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101784
Gene: ENSMUSG00000042988
AA Change: V48A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
Pfam:PAE 88 426 4.6e-93 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126642
Predicted Effect probably benign
Transcript: ENSMUST00000150458
AA Change: V48A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122788
Gene: ENSMUSG00000042988
AA Change: V48A

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 31 44 N/A INTRINSIC
Pfam:PAE 78 215 1.2e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151998
Meta Mutation Damage Score 0.042 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.6%
  • 10x: 94.5%
  • 20x: 80.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8b A G 11: 109,955,176 C811R possibly damaging Het
AI481877 A C 4: 59,093,850 L226R probably damaging Het
Ak8 T C 2: 28,742,720 I317T possibly damaging Het
Als2 A G 1: 59,211,137 S483P probably damaging Het
Arhgef10 T C 8: 14,975,093 probably null Het
Arhgef10 A G 8: 14,975,666 I459V probably benign Het
Armc2 C T 10: 41,966,700 probably null Het
Atp12a A G 14: 56,386,950 R952G possibly damaging Het
Atp6v1g1 A G 4: 63,550,021 Y87C probably benign Het
Col12a1 A T 9: 79,699,549 F531I probably damaging Het
Csmd2 T C 4: 128,557,718 F113S unknown Het
Ctnnd1 C T 2: 84,620,888 V123I possibly damaging Het
Cyp4a14 C A 4: 115,487,301 G456W probably damaging Het
Cyp4a30b A G 4: 115,458,362 H260R possibly damaging Het
Eef2 GCCC GCCCC 10: 81,178,767 probably null Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Frmpd4 A T X: 167,477,247 D1166E probably benign Het
Gpr156 T A 16: 37,992,223 V307D probably damaging Het
Gpr35 G A 1: 92,983,126 V187I probably benign Het
Gria2 G A 3: 80,702,492 T670I probably damaging Het
Hdac10 G T 15: 89,125,856 Q300K possibly damaging Het
Hdhd2 T C 18: 76,955,006 F44L probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hmcn1 A T 1: 150,738,716 V1313D possibly damaging Het
Ick A T 9: 78,140,100 probably null Het
Ift172 C T 5: 31,257,861 V1335I probably benign Het
Igsf9b A G 9: 27,322,223 I340V probably benign Het
Kif1c A G 11: 70,724,081 E567G probably damaging Het
Klf8 A T X: 153,382,682 E82D probably damaging Het
Matr3 T A 18: 35,572,296 S91R probably benign Het
Mroh2a GCCC GC 1: 88,232,257 probably null Het
Mtor T A 4: 148,540,030 M2089K probably benign Het
Myo9b T C 8: 71,290,966 Y224H probably benign Het
Nlrc3 T C 16: 3,957,326 D774G possibly damaging Het
Nox3 T C 17: 3,682,916 H240R probably damaging Het
Nsun2 A G 13: 69,629,682 T425A probably damaging Het
Olfr1510 T G 14: 52,410,861 T4P probably benign Het
Olfr419 T C 1: 174,250,526 S134G probably benign Het
Olfr654 T C 7: 104,588,493 S230P possibly damaging Het
Olfr99 A G 17: 37,279,976 V148A possibly damaging Het
Ostc T C 3: 130,703,508 N80S probably damaging Het
Otud4 T A 8: 79,661,073 N300K possibly damaging Het
Palmd T C 3: 116,923,751 R366G possibly damaging Het
Paqr5 A T 9: 61,968,779 probably null Het
Parp1 A G 1: 180,573,665 D45G probably damaging Het
Pcdhga9 T A 18: 37,737,471 Y118N possibly damaging Het
Pkd1l2 C T 8: 117,038,164 V1332I probably benign Het
Plcl1 A T 1: 55,697,150 D550V probably benign Het
Plekhg1 T G 10: 3,963,982 S1235A probably benign Het
Plekhg5 T A 4: 152,107,503 C433S probably benign Het
Plin2 A G 4: 86,668,678 M1T probably null Het
Polg2 A G 11: 106,775,425 probably null Het
Ppp1r7 T A 1: 93,357,863 probably null Het
Prdx4 A G X: 155,340,464 V15A probably benign Het
Rapgef6 T A 11: 54,661,175 F956L probably damaging Het
Rasl12 A G 9: 65,408,323 N83S probably benign Het
Rel T C 11: 23,761,129 I13V probably benign Het
Reln C T 5: 22,049,791 V527I possibly damaging Het
Sel1l3 C T 5: 53,137,883 W792* probably null Het
Slc39a8 T A 3: 135,886,793 probably null Het
Slc6a9 T A 4: 117,849,381 M1K probably null Het
Smpdl3a T A 10: 57,802,530 F143Y possibly damaging Het
Spsb4 G T 9: 96,996,018 T84K probably damaging Het
Tbc1d8 A G 1: 39,405,317 F187S probably damaging Het
Tdpoz3 T A 3: 93,826,428 F137I probably benign Het
Tgm7 G A 2: 121,109,693 probably benign Het
Tnni3k C T 3: 154,938,750 probably null Het
Tpd52 A T 3: 9,003,406 Y16* probably null Het
Trpa1 A G 1: 14,887,620 C705R probably damaging Het
Ttn A G 2: 76,750,851 S23233P probably damaging Het
Uevld T C 7: 46,947,945 D154G probably null Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Zfp292 G A 4: 34,808,595 T1483M probably damaging Het
Other mutations in Notum
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01483:Notum APN 11 120656656 missense probably damaging 1.00
R0265:Notum UTSW 11 120658334 missense probably benign 0.09
R0383:Notum UTSW 11 120654456 missense probably benign
R1268:Notum UTSW 11 120658667 nonsense probably null
R1311:Notum UTSW 11 120655749 unclassified probably benign
R2249:Notum UTSW 11 120654411 missense probably benign
R2869:Notum UTSW 11 120660196 missense probably benign
R2869:Notum UTSW 11 120660196 missense probably benign
R2871:Notum UTSW 11 120660196 missense probably benign
R2871:Notum UTSW 11 120660196 missense probably benign
R2872:Notum UTSW 11 120660196 missense probably benign
R2873:Notum UTSW 11 120660196 missense probably benign
R5617:Notum UTSW 11 120656345 nonsense probably null
R6298:Notum UTSW 11 120657940 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACGTGTTCAGCAGGAGGTG -3'
(R):5'- GAGGAGCAGCAGTGTCTTG -3'

Sequencing Primer
(F):5'- TGAAGGCGCAGGTCCTCATTG -3'
(R):5'- AGCAGTGTCTTGCGCGC -3'
Posted On2014-12-04