Incidental Mutation 'R2760:Olfr1200'
ID253977
Institutional Source Beutler Lab
Gene Symbol Olfr1200
Ensembl Gene ENSMUSG00000075115
Gene Nameolfactory receptor 1200
SynonymsMOR225-12, GA_x6K02T2Q125-50243231-50242221
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R2760 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location88763511-88770488 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88767636 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 226 (R226S)
Ref Sequence ENSEMBL: ENSMUSP00000149757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099811] [ENSMUST00000217588]
Predicted Effect possibly damaging
Transcript: ENSMUST00000099811
AA Change: R226S

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097399
Gene: ENSMUSG00000075115
AA Change: R226S

DomainStartEndE-ValueType
Pfam:7tm_4 29 302 3.2e-47 PFAM
Pfam:7tm_1 39 285 2.3e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000217588
AA Change: R226S

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg11 C A 8: 22,068,079 A469E probably benign Het
Atp8a2 C T 14: 59,860,192 V796I probably benign Het
Btnl1 T G 17: 34,381,038 W172G probably damaging Het
Ceacam1 T C 7: 25,477,474 T21A probably damaging Het
Fam69b A G 2: 26,635,825 H257R probably benign Het
Frmpd1 A C 4: 45,244,667 I119L possibly damaging Het
Haus6 A T 4: 86,583,176 Y819* probably null Het
Ildr2 A G 1: 166,303,606 R344G probably damaging Het
Irs1 T C 1: 82,288,570 I642V probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Lum T C 10: 97,568,771 V176A probably benign Het
Nobox A G 6: 43,304,106 L478P probably damaging Het
Olfr1415 A G 1: 92,491,080 V225A probably damaging Het
Olfr544 T C 7: 102,484,376 H248R probably damaging Het
Olfr8 A T 10: 78,956,042 Y279F probably damaging Het
Olfr981 T A 9: 40,022,396 M1K probably null Het
Rtn1 A T 12: 72,408,362 C64S probably benign Het
Senp6 A G 9: 80,121,978 Y285C probably null Het
Slco1a5 C A 6: 142,250,271 M335I probably benign Het
Spg11 A T 2: 122,097,359 I648K probably damaging Het
Ube2cbp T C 9: 86,422,974 I272V probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Utrn A G 10: 12,690,878 V1180A probably damaging Het
Vill T C 9: 119,066,882 probably null Het
Vmn2r101 T C 17: 19,589,639 I229T probably benign Het
Zbtb8b A T 4: 129,432,500 L291M probably benign Het
Other mutations in Olfr1200
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Olfr1200 APN 2 88767466 missense probably benign 0.01
PIT4520001:Olfr1200 UTSW 2 88767577 missense possibly damaging 0.95
R0375:Olfr1200 UTSW 2 88767641 missense possibly damaging 0.77
R0525:Olfr1200 UTSW 2 88767314 nonsense probably null
R1467:Olfr1200 UTSW 2 88767488 missense probably benign 0.02
R1467:Olfr1200 UTSW 2 88767488 missense probably benign 0.02
R1613:Olfr1200 UTSW 2 88767805 missense probably damaging 1.00
R2224:Olfr1200 UTSW 2 88767586 missense possibly damaging 0.89
R3434:Olfr1200 UTSW 2 88768069 missense probably damaging 1.00
R6156:Olfr1200 UTSW 2 88767590 missense probably benign 0.01
R6251:Olfr1200 UTSW 2 88768288 missense probably damaging 1.00
R6582:Olfr1200 UTSW 2 88768243 missense probably damaging 0.96
R6592:Olfr1200 UTSW 2 88768127 missense probably damaging 1.00
R6600:Olfr1200 UTSW 2 88767757 missense probably benign 0.02
R6774:Olfr1200 UTSW 2 88767884 missense probably benign 0.00
R7140:Olfr1200 UTSW 2 88767964 missense probably damaging 1.00
X0026:Olfr1200 UTSW 2 88767433 missense probably benign
Predicted Primers PCR Primer
(F):5'- GACCACACTTTGTGCATGGC -3'
(R):5'- GTGCTCAGTCTGCCATTCTG -3'

Sequencing Primer
(F):5'- CTCAGTGTGTAGATGACAGGATTTAG -3'
(R):5'- CCATTCTGTGGTCCCAACC -3'
Posted On2014-12-04