Incidental Mutation 'R2518:Ren1'
ID254020
Institutional Source Beutler Lab
Gene Symbol Ren1
Ensembl Gene ENSMUSG00000070645
Gene Namerenin 1 structural
SynonymsRen-1, Ren1d, Ren1c, Ren, Ren-A, Rnr, Rn-1
MMRRC Submission 040422-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2518 (G1)
Quality Score161
Status Not validated
Chromosome1
Chromosomal Location133350510-133360325 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 133360124 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 399 (A399T)
Ref Sequence ENSEMBL: ENSMUSP00000092135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094556] [ENSMUST00000135222]
Predicted Effect probably damaging
Transcript: ENSMUST00000094556
AA Change: A399T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092135
Gene: ENSMUSG00000070645
AA Change: A399T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:A1_Propeptide 29 54 1.2e-10 PFAM
Pfam:Asp 83 401 1.3e-120 PFAM
Pfam:TAXi_C 261 400 1.4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135222
SMART Domains Protein: ENSMUSP00000114272
Gene: ENSMUSG00000070644

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:APH 84 331 1e-19 PFAM
Pfam:Choline_kinase 104 303 2.7e-64 PFAM
Pfam:EcKinase 163 313 2.8e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147909
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Renin catalyzes the first step in the activation pathway of angiotensinogen--a cascade that can result in aldosterone release,vasoconstriction, and increase in blood pressure. Renin, an aspartyl protease, cleaves angiotensinogen to form angiotensin I, which is converted to angiotensin II by angiotensin I converting enzyme, an important regulator of blood pressure and electrolyte balance. Transcript variants that encode different protein isoforms and that arise from alternative splicing and the use of alternative promoters have been described, but their full-length nature has not been determined. Mutations in this gene have been shown to cause familial hyperproreninemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to postnatal lethality, reduced plasma renin level, decreased mean arterial pressure, and kidney defects such as atrophy, altered juxtaglomerular cell and macula densa morphology, polyuria, decreased urine osmolality, and reduced glomerular filtration rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110034G24Rik T A 2: 132,750,527 S165T probably damaging Het
Adam18 A G 8: 24,637,141 C480R probably damaging Het
Aftph G T 11: 20,725,797 T604K probably damaging Het
Bivm T C 1: 44,129,615 V279A probably damaging Het
C2cd2 G A 16: 97,922,086 T77I probably benign Het
Ccdc146 T C 5: 21,305,528 H527R probably benign Het
Cd226 A G 18: 89,207,327 N116S probably benign Het
Cit A G 5: 115,987,046 K1612E probably damaging Het
Cmtr1 T A 17: 29,681,980 Y663* probably null Het
Col3a1 T A 1: 45,337,512 probably benign Het
Copa A G 1: 172,119,901 N1095D probably benign Het
Cpne1 G T 2: 156,073,971 A433E probably damaging Het
Cyfip1 C T 7: 55,928,284 L1181F probably damaging Het
Dnajc6 T A 4: 101,612,930 I220N probably damaging Het
Duxbl1 G C 14: 25,987,748 probably benign Het
Fam135b C T 15: 71,463,911 R478H probably benign Het
Fam91a1 T A 15: 58,450,600 S734T possibly damaging Het
Fut10 T G 8: 31,236,467 S417A probably benign Het
Gm9945 C T 11: 53,480,336 probably benign Het
Golga4 A G 9: 118,556,612 E934G probably damaging Het
Gpat2 G A 2: 127,428,291 V75M probably damaging Het
Hdac5 A G 11: 102,197,136 V949A probably damaging Het
Hdgfl1 G T 13: 26,769,749 L114I probably benign Het
Ifi27l2b T A 12: 103,455,824 M94L unknown Het
Irs2 C A 8: 11,005,352 A1027S probably benign Het
Itga2 A T 13: 114,881,042 C111S probably damaging Het
Khdrbs1 T C 4: 129,720,747 T338A probably benign Het
Klk1 T C 7: 44,220,737 probably null Het
Kmt2b T C 7: 30,576,068 N1822S probably benign Het
Lrig3 T C 10: 125,994,441 I136T probably benign Het
Lyar T A 5: 38,227,932 D105E probably benign Het
Mat1a T A 14: 41,122,512 D366E probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Neb T A 2: 52,249,511 K95* probably null Het
Nectin4 A G 1: 171,380,208 D56G probably benign Het
Nupl1 A T 14: 60,232,660 F334Y probably damaging Het
Olfr1502 A G 19: 13,862,309 N172S probably damaging Het
Olfr294 A T 7: 86,616,187 F153I probably benign Het
Pde8a C A 7: 81,317,422 T437K probably benign Het
Ppp1r3a A T 6: 14,719,378 N512K possibly damaging Het
Pqlc2 A G 4: 139,302,499 F74L probably damaging Het
Pramef8 A G 4: 143,417,903 Q273R possibly damaging Het
Rad51ap2 A G 12: 11,457,067 D330G probably damaging Het
Rnft2 G T 5: 118,194,605 probably benign Het
Sept14 A T 5: 129,699,035 S27T probably benign Het
Shox2 T C 3: 66,978,359 K128E possibly damaging Het
Skint1 T C 4: 112,025,481 W241R probably benign Het
Slc24a4 T A 12: 102,222,051 H134Q probably benign Het
Slc25a36 A T 9: 97,079,071 L165Q possibly damaging Het
Slc35f1 A G 10: 53,073,534 I240V probably benign Het
Tab2 G A 10: 7,907,481 P679L probably damaging Het
Tarbp2 A G 15: 102,518,557 E3G possibly damaging Het
Tas2r130 A T 6: 131,630,073 I253K probably damaging Het
Timm44 A C 8: 4,266,588 C319G probably null Het
Tjap1 A T 17: 46,260,095 N165K probably damaging Het
Tmem63b A G 17: 45,666,154 I429T probably benign Het
Trabd2b A T 4: 114,599,903 D339V probably damaging Het
Tst T C 15: 78,405,833 M1V probably null Het
Ube4a A T 9: 44,948,137 N335K probably benign Het
Vps54 C T 11: 21,306,394 T633M probably benign Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp953 A G 13: 67,347,939 Y13H probably damaging Het
Other mutations in Ren1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01916:Ren1 APN 1 133358412 missense probably benign 0.00
IGL02172:Ren1 APN 1 133359033 missense possibly damaging 0.95
IGL02686:Ren1 APN 1 133358469 missense possibly damaging 0.86
3_musketeers UTSW 1 133354808 missense probably damaging 1.00
snickers UTSW 1 133356518 missense probably damaging 1.00
R0268:Ren1 UTSW 1 133355611 missense possibly damaging 0.74
R1115:Ren1 UTSW 1 133356518 missense probably damaging 1.00
R1728:Ren1 UTSW 1 133354206 missense probably damaging 0.99
R1728:Ren1 UTSW 1 133354237 missense probably benign 0.12
R1728:Ren1 UTSW 1 133356457 missense probably benign 0.29
R1728:Ren1 UTSW 1 133358982 unclassified probably null
R1728:Ren1 UTSW 1 133359079 missense probably benign
R1728:Ren1 UTSW 1 133359983 missense probably benign
R1728:Ren1 UTSW 1 133360007 missense probably benign 0.02
R1729:Ren1 UTSW 1 133354206 missense probably damaging 0.99
R1729:Ren1 UTSW 1 133354237 missense probably benign 0.12
R1729:Ren1 UTSW 1 133359079 missense probably benign
R1729:Ren1 UTSW 1 133360007 missense probably benign 0.02
R1730:Ren1 UTSW 1 133354206 missense probably damaging 0.99
R1730:Ren1 UTSW 1 133354237 missense probably benign 0.12
R1730:Ren1 UTSW 1 133356457 missense probably benign 0.29
R1730:Ren1 UTSW 1 133359079 missense probably benign
R1730:Ren1 UTSW 1 133359983 missense probably benign
R1730:Ren1 UTSW 1 133360007 missense probably benign 0.02
R1739:Ren1 UTSW 1 133354206 missense probably damaging 0.99
R1739:Ren1 UTSW 1 133354237 missense probably benign 0.12
R1739:Ren1 UTSW 1 133356457 missense probably benign 0.29
R1739:Ren1 UTSW 1 133359079 missense probably benign
R1739:Ren1 UTSW 1 133359983 missense probably benign
R1739:Ren1 UTSW 1 133360007 missense probably benign 0.02
R1762:Ren1 UTSW 1 133354206 missense probably damaging 0.99
R1762:Ren1 UTSW 1 133354237 missense probably benign 0.12
R1762:Ren1 UTSW 1 133358982 unclassified probably null
R1762:Ren1 UTSW 1 133359079 missense probably benign
R1762:Ren1 UTSW 1 133360007 missense probably benign 0.02
R1783:Ren1 UTSW 1 133350778 unclassified probably null
R1783:Ren1 UTSW 1 133354206 missense probably damaging 0.99
R1783:Ren1 UTSW 1 133354237 missense probably benign 0.12
R1783:Ren1 UTSW 1 133359079 missense probably benign
R1783:Ren1 UTSW 1 133359983 missense probably benign
R1783:Ren1 UTSW 1 133360007 missense probably benign 0.02
R1784:Ren1 UTSW 1 133350778 unclassified probably null
R1784:Ren1 UTSW 1 133354206 missense probably damaging 0.99
R1784:Ren1 UTSW 1 133354237 missense probably benign 0.12
R1784:Ren1 UTSW 1 133356457 missense probably benign 0.29
R1784:Ren1 UTSW 1 133359079 missense probably benign
R1784:Ren1 UTSW 1 133359983 missense probably benign
R1784:Ren1 UTSW 1 133360007 missense probably benign 0.02
R1785:Ren1 UTSW 1 133350778 unclassified probably null
R1785:Ren1 UTSW 1 133354206 missense probably damaging 0.99
R1785:Ren1 UTSW 1 133354237 missense probably benign 0.12
R1785:Ren1 UTSW 1 133359079 missense probably benign
R1785:Ren1 UTSW 1 133359983 missense probably benign
R1785:Ren1 UTSW 1 133360007 missense probably benign 0.02
R2049:Ren1 UTSW 1 133350778 unclassified probably null
R2130:Ren1 UTSW 1 133350778 unclassified probably null
R2131:Ren1 UTSW 1 133350778 unclassified probably null
R2133:Ren1 UTSW 1 133358982 unclassified probably null
R2141:Ren1 UTSW 1 133350778 unclassified probably null
R2142:Ren1 UTSW 1 133350778 unclassified probably null
R4361:Ren1 UTSW 1 133359041 missense probably benign
R4584:Ren1 UTSW 1 133354808 missense probably damaging 1.00
R5188:Ren1 UTSW 1 133350613 unclassified probably benign
R5806:Ren1 UTSW 1 133355511 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TACACTGAAGACTGTTGCTCCAC -3'
(R):5'- TTTCCTTAAAGCAGGGAAGGG -3'

Sequencing Primer
(F):5'- GAAGACTGTTGCTCCACTCTGG -3'
(R):5'- CTTAAAGCAGGGAAGGGTGAGTG -3'
Posted On2014-12-04