Mutagenetix > Incidental Mutation

Incidental Mutation 'R2761:Col11a2'

254070

Institutional Source

Beutler Lab

Gene Symbol

Col11a2

Ensembl Gene

ENSMUSG00000024330

Gene Name

collagen, type XI, alpha 2

Synonyms

Accession Numbers

Essential gene?

Probably essential (E-score: 0.936) question?

Stock #

R2761 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

34258411-34285659 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 34270000 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 477 (I477V)

Ref Sequence

ENSEMBL: ENSMUSP00000122082 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087497] [ENSMUST00000114252] [ENSMUST00000114255] [ENSMUST00000131134] [ENSMUST00000143354]

AlphaFold

Q64739

Predicted Effect

probably damaging
Transcript: ENSMUST00000087497
AA Change: I391V

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000084772
Gene: ENSMUSG00000024330
AA Change: I391V

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
TSPN	31	214	4.25e-72	SMART
LamG	82	213	1.08e-9	SMART
Pfam:Collagen	306	364	2.2e-9	PFAM
Pfam:Collagen	399	460	1e-10	PFAM
Pfam:Collagen	437	520	1.2e-7	PFAM
Pfam:Collagen	479	553	5.7e-9	PFAM
Pfam:Collagen	506	579	1.6e-8	PFAM
internal_repeat_4	584	614	3.98e-5	PROSPERO
internal_repeat_2	584	669	5.49e-20	PROSPERO
internal_repeat_1	587	740	2.58e-22	PROSPERO
Pfam:Collagen	743	814	1.5e-8	PFAM
Pfam:Collagen	767	839	4.8e-7	PFAM
low complexity region	854	872	N/A	INTRINSIC
Pfam:Collagen	881	946	4.5e-8	PFAM
Pfam:Collagen	905	976	2e-7	PFAM
Pfam:Collagen	933	1002	2.7e-8	PFAM
low complexity region	1013	1047	N/A	INTRINSIC
low complexity region	1064	1112	N/A	INTRINSIC
low complexity region	1121	1199	N/A	INTRINSIC
low complexity region	1216	1232	N/A	INTRINSIC
low complexity region	1289	1320	N/A	INTRINSIC
Pfam:Collagen	1358	1417	1.7e-8	PFAM
COLFI	1454	1649	4.42e-117	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000114252
AA Change: I396V

PolyPhen 2 Score 0.236 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000109890
Gene: ENSMUSG00000024330
AA Change: I396V

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
TSPN	31	214	4.25e-72	SMART
LamG	82	213	1.08e-9	SMART
Pfam:Collagen	311	369	2.3e-9	PFAM
Pfam:Collagen	404	465	1.1e-10	PFAM
Pfam:Collagen	442	525	1.3e-7	PFAM
Pfam:Collagen	484	558	6.4e-9	PFAM
Pfam:Collagen	511	584	1.7e-8	PFAM
internal_repeat_4	589	619	3.69e-5	PROSPERO
internal_repeat_2	589	674	4.46e-20	PROSPERO
internal_repeat_1	592	745	2.05e-22	PROSPERO
internal_repeat_3	636	752	7.84e-10	PROSPERO
Pfam:Collagen	772	844	5.5e-7	PFAM
Pfam:Collagen	800	869	1.9e-8	PFAM
Pfam:Collagen	886	951	5e-8	PFAM
Pfam:Collagen	910	981	2.2e-7	PFAM
Pfam:Collagen	934	1007	6.9e-7	PFAM
low complexity region	1018	1052	N/A	INTRINSIC
low complexity region	1069	1117	N/A	INTRINSIC
low complexity region	1126	1204	N/A	INTRINSIC
low complexity region	1221	1237	N/A	INTRINSIC
low complexity region	1294	1325	N/A	INTRINSIC
Pfam:Collagen	1363	1422	1.9e-8	PFAM
COLFI	1459	1654	4.42e-117	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114255
AA Change: I430V

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000109893
Gene: ENSMUSG00000024330
AA Change: I430V

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
TSPN	31	214	4.25e-72	SMART
LamG	82	213	1.08e-9	SMART
low complexity region	257	268	N/A	INTRINSIC
low complexity region	295	307	N/A	INTRINSIC
Pfam:Collagen	345	403	2.1e-9	PFAM
Pfam:Collagen	438	499	1.1e-10	PFAM
Pfam:Collagen	521	593	2.2e-8	PFAM
Pfam:Collagen	545	613	9.1e-10	PFAM
internal_repeat_4	623	653	2.83e-5	PROSPERO
internal_repeat_2	623	708	2.11e-20	PROSPERO
internal_repeat_1	626	779	9e-23	PROSPERO
internal_repeat_3	670	786	5.16e-10	PROSPERO
low complexity region	788	819	N/A	INTRINSIC
low complexity region	830	857	N/A	INTRINSIC
low complexity region	866	887	N/A	INTRINSIC
low complexity region	893	911	N/A	INTRINSIC
low complexity region	919	935	N/A	INTRINSIC
Pfam:Collagen	973	1041	2.9e-8	PFAM
low complexity region	1052	1086	N/A	INTRINSIC
low complexity region	1103	1151	N/A	INTRINSIC
low complexity region	1160	1238	N/A	INTRINSIC
low complexity region	1255	1271	N/A	INTRINSIC
low complexity region	1328	1359	N/A	INTRINSIC
Pfam:Collagen	1394	1456	1.5e-8	PFAM
COLFI	1493	1688	4.42e-117	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000131134
AA Change: I477V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000122082
Gene: ENSMUSG00000024330
AA Change: I477V

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
TSPN	31	214	4.25e-72	SMART
LamG	82	213	1.08e-9	SMART
low complexity region	303	314	N/A	INTRINSIC
low complexity region	342	354	N/A	INTRINSIC
Pfam:Collagen	392	450	7.8e-10	PFAM
Pfam:Collagen	484	543	1.4e-10	PFAM
Pfam:Collagen	514	581	9.5e-11	PFAM
Pfam:Collagen	565	624	2.1e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137374

Predicted Effect

probably benign
Transcript: ENSMUST00000143354
AA Change: I83V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000115026
Gene: ENSMUSG00000024330
AA Change: I83V

Domain	Start	End	E-Value	Type
Pfam:Collagen	3	56	4.7e-9	PFAM
Pfam:Collagen	91	152	1.7e-9	PFAM
internal_repeat_1	158	301	3.7e-11	PROSPERO
internal_repeat_2	276	321	1.18e-9	PROSPERO
internal_repeat_4	291	306	1.06e-5	PROSPERO
internal_repeat_3	303	353	1.87e-6	PROSPERO
internal_repeat_2	315	360	1.18e-9	PROSPERO
internal_repeat_1	323	439	3.7e-11	PROSPERO
low complexity region	441	472	N/A	INTRINSIC
low complexity region	483	510	N/A	INTRINSIC
low complexity region	519	540	N/A	INTRINSIC
low complexity region	546	564	N/A	INTRINSIC
low complexity region	572	588	N/A	INTRINSIC
Pfam:Collagen	603	673	6.6e-6	PFAM
Pfam:Collagen	627	694	5.4e-7	PFAM
Pfam:Collagen	660	734	3.2e-7	PFAM
Pfam:Collagen	711	770	1.1e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000173749

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes the alpha-2 subunit of type XI collagen, one of the low abundance fibrillar collagens found in cartilage. The encoded protein, in association with other collagen subunits, forms a heterotrimeric type XI procollagen that may undergo proteolytic processing similar to the alpha-1 subunit. Mice lacking the encoded protein exhibit a mild phenotype similar to nonocular Stickler syndrome, otospondylomegaepiphyseal dysplasia (OSMED) as well as a nonsyndromic form of deafness called DFNA13. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygous mutant animals exhibit reduced body size, short snout, a slightly bulged forehead, deafness, and disorganization of chondrocytes in the growth plate of long bones. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 13 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	T	C	3: 137,773,541 (GRCm39)	V910A	probably damaging	Het
1700123K08Rik	T	C	5: 138,562,436 (GRCm39)	T102A	possibly damaging	Het
Acoxl	T	C	2: 127,719,733 (GRCm39)	Y165H	probably benign	Het
Alg11	C	A	8: 22,558,095 (GRCm39)	A469E	probably benign	Het
Cdh1	T	A	8: 107,380,481 (GRCm39)	I208N	possibly damaging	Het
Cpa2	A	G	6: 30,554,193 (GRCm39)	D271G	probably damaging	Het
Dzank1	T	C	2: 144,355,369 (GRCm39)	M109V	probably benign	Het
Hdac3	A	T	18: 38,078,779 (GRCm39)	S111T	probably benign	Het
Kremen1	GGG	GGGTGG	11: 5,151,792 (GRCm39)		probably benign	Het
Krt31	T	C	11: 99,938,691 (GRCm39)	T301A	probably benign	Het
Rad21	T	A	15: 51,846,039 (GRCm39)	K10N	probably damaging	Het
Snap47	T	C	11: 59,328,885 (GRCm39)	D139G	probably benign	Het
Tango6	C	A	8: 107,425,664 (GRCm39)	T408N	possibly damaging	Het

Other mutations in Col11a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01723:Col11a2	APN	17	34,280,254 (GRCm39)	unclassified	probably benign
IGL01839:Col11a2	APN	17	34,283,056 (GRCm39)	unclassified	probably benign
IGL02429:Col11a2	APN	17	34,261,266 (GRCm39)	missense	probably damaging	1.00
IGL02491:Col11a2	APN	17	34,283,181 (GRCm39)	unclassified	probably benign
BB010:Col11a2	UTSW	17	34,275,029 (GRCm39)	nonsense	probably null
BB020:Col11a2	UTSW	17	34,275,029 (GRCm39)	nonsense	probably null
PIT4531001:Col11a2	UTSW	17	34,265,412 (GRCm39)	critical splice acceptor site	probably null
R0001:Col11a2	UTSW	17	34,280,586 (GRCm39)	missense	probably benign	0.00
R0005:Col11a2	UTSW	17	34,281,853 (GRCm39)	unclassified	probably benign
R0099:Col11a2	UTSW	17	34,268,648 (GRCm39)	missense	probably damaging	0.99
R0106:Col11a2	UTSW	17	34,276,249 (GRCm39)	missense	probably damaging	0.99
R0243:Col11a2	UTSW	17	34,281,520 (GRCm39)	unclassified	probably benign
R0254:Col11a2	UTSW	17	34,283,777 (GRCm39)	unclassified	probably benign
R0352:Col11a2	UTSW	17	34,261,501 (GRCm39)	missense	probably benign	0.43
R0362:Col11a2	UTSW	17	34,281,420 (GRCm39)	splice site	probably null
R0491:Col11a2	UTSW	17	34,261,186 (GRCm39)	missense	probably null	0.00
R0531:Col11a2	UTSW	17	34,277,351 (GRCm39)	splice site	probably benign
R0538:Col11a2	UTSW	17	34,270,302 (GRCm39)	splice site	probably benign
R0646:Col11a2	UTSW	17	34,278,322 (GRCm39)	critical splice donor site	probably null
R0676:Col11a2	UTSW	17	34,276,249 (GRCm39)	missense	probably damaging	0.99
R0919:Col11a2	UTSW	17	34,278,124 (GRCm39)	missense	possibly damaging	0.93
R1522:Col11a2	UTSW	17	34,274,228 (GRCm39)	missense	probably damaging	1.00
R1767:Col11a2	UTSW	17	34,282,869 (GRCm39)	unclassified	probably benign
R1872:Col11a2	UTSW	17	34,281,529 (GRCm39)	unclassified	probably benign
R1941:Col11a2	UTSW	17	34,263,925 (GRCm39)	missense	probably benign	0.01
R1945:Col11a2	UTSW	17	34,278,142 (GRCm39)	missense	probably damaging	1.00
R2101:Col11a2	UTSW	17	34,271,143 (GRCm39)	missense	probably damaging	1.00
R2161:Col11a2	UTSW	17	34,283,771 (GRCm39)	unclassified	probably benign
R2258:Col11a2	UTSW	17	34,258,651 (GRCm39)	missense	probably benign
R2259:Col11a2	UTSW	17	34,258,651 (GRCm39)	missense	probably benign
R2260:Col11a2	UTSW	17	34,258,651 (GRCm39)	missense	probably benign
R3114:Col11a2	UTSW	17	34,265,442 (GRCm39)	missense	possibly damaging	0.69
R3824:Col11a2	UTSW	17	34,273,154 (GRCm39)	missense	probably damaging	1.00
R3938:Col11a2	UTSW	17	34,258,599 (GRCm39)	unclassified	probably benign
R4039:Col11a2	UTSW	17	34,264,748 (GRCm39)	missense	probably benign	0.00
R4675:Col11a2	UTSW	17	34,283,267 (GRCm39)	critical splice donor site	probably null
R4810:Col11a2	UTSW	17	34,276,086 (GRCm39)	missense	probably damaging	0.99
R4824:Col11a2	UTSW	17	34,269,937 (GRCm39)	missense	probably damaging	1.00
R4944:Col11a2	UTSW	17	34,261,164 (GRCm39)	missense	possibly damaging	0.47
R5112:Col11a2	UTSW	17	34,283,062 (GRCm39)	unclassified	probably benign
R5355:Col11a2	UTSW	17	34,270,775 (GRCm39)	missense	probably benign	0.07
R5384:Col11a2	UTSW	17	34,278,148 (GRCm39)	critical splice donor site	probably null
R5534:Col11a2	UTSW	17	34,269,998 (GRCm39)	missense	probably damaging	0.99
R5860:Col11a2	UTSW	17	34,283,159 (GRCm39)	unclassified	probably benign
R6252:Col11a2	UTSW	17	34,261,186 (GRCm39)	missense	probably null	0.00
R6327:Col11a2	UTSW	17	34,262,291 (GRCm39)	missense	probably benign	0.32
R6828:Col11a2	UTSW	17	34,272,607 (GRCm39)	splice site	probably null
R6860:Col11a2	UTSW	17	34,272,572 (GRCm39)	missense	probably damaging	1.00
R6873:Col11a2	UTSW	17	34,283,993 (GRCm39)	missense	unknown
R6992:Col11a2	UTSW	17	34,266,118 (GRCm39)	missense	probably benign	0.01
R7292:Col11a2	UTSW	17	34,270,482 (GRCm39)	missense	unknown
R7543:Col11a2	UTSW	17	34,269,430 (GRCm39)	missense	unknown
R7933:Col11a2	UTSW	17	34,275,029 (GRCm39)	nonsense	probably null
R8157:Col11a2	UTSW	17	34,280,230 (GRCm39)	missense	unknown
R8161:Col11a2	UTSW	17	34,270,264 (GRCm39)	missense	unknown
R8209:Col11a2	UTSW	17	34,266,253 (GRCm39)	critical splice donor site	probably null
R8493:Col11a2	UTSW	17	34,278,936 (GRCm39)	missense	possibly damaging	0.82
R8705:Col11a2	UTSW	17	34,268,769 (GRCm39)	missense	unknown
R8901:Col11a2	UTSW	17	34,262,254 (GRCm39)	missense	probably damaging	1.00
R8946:Col11a2	UTSW	17	34,270,757 (GRCm39)	missense	probably benign	0.40
R9010:Col11a2	UTSW	17	34,283,760 (GRCm39)	missense	unknown
R9108:Col11a2	UTSW	17	34,276,634 (GRCm39)	missense	probably benign	0.21
R9138:Col11a2	UTSW	17	34,279,847 (GRCm39)	missense
R9147:Col11a2	UTSW	17	34,273,119 (GRCm39)	splice site	probably benign
R9148:Col11a2	UTSW	17	34,273,119 (GRCm39)	splice site	probably benign
R9338:Col11a2	UTSW	17	34,266,204 (GRCm39)	missense	unknown
R9485:Col11a2	UTSW	17	34,258,669 (GRCm39)	missense	unknown
X0017:Col11a2	UTSW	17	34,278,959 (GRCm39)	critical splice donor site	probably null
X0064:Col11a2	UTSW	17	34,261,221 (GRCm39)	missense	possibly damaging	0.88
Z1176:Col11a2	UTSW	17	34,275,376 (GRCm39)	missense	unknown
Z1177:Col11a2	UTSW	17	34,270,640 (GRCm39)	missense	probably benign	0.40

Predicted Primers

PCR Primer
(F):5'- AGAAGCCTCTGAGTGCTGTG -3'
(R):5'- TCACTCACCAATGGTCCAGG -3'

Sequencing Primer
(F):5'- CTCTGAGTGCTGTGCCAGAG -3'
(R):5'- AGGCAATGTGACAGAATCCC -3'

Posted On

2014-12-04