Incidental Mutation 'R2518:Adam18'
ID254075
Institutional Source Beutler Lab
Gene Symbol Adam18
Ensembl Gene ENSMUSG00000031552
Gene Namea disintegrin and metallopeptidase domain 18
SynonymsAdam27, Dtgn3
MMRRC Submission 040422-MU
Accession Numbers

Genbank: NM_010084

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2518 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location24602246-24674755 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24637141 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 480 (C480R)
Ref Sequence ENSEMBL: ENSMUSP00000133378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033957] [ENSMUST00000173833]
Predicted Effect probably damaging
Transcript: ENSMUST00000033957
AA Change: C480R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000033957
Gene: ENSMUSG00000031552
AA Change: C480R

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 15 140 1.7e-25 PFAM
Pfam:Reprolysin 180 377 1.1e-57 PFAM
DISIN 396 474 1.03e-35 SMART
ACR 475 613 1.12e-51 SMART
transmembrane domain 684 703 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000173833
AA Change: C480R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133378
Gene: ENSMUSG00000031552
AA Change: C480R

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 15 140 9.5e-35 PFAM
Pfam:Reprolysin 180 378 7.7e-56 PFAM
DISIN 396 474 1.03e-35 SMART
ACR 475 613 1.12e-51 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is expressed in a regulated fashion during early stages of spermatogenesis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of related ADAM genes on chromosome 8. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous mutant mice exhibit enhanced motor coordination during inverted screen testing when compared with that of controls. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110034G24Rik T A 2: 132,750,527 S165T probably damaging Het
Aftph G T 11: 20,725,797 T604K probably damaging Het
Bivm T C 1: 44,129,615 V279A probably damaging Het
C2cd2 G A 16: 97,922,086 T77I probably benign Het
Ccdc146 T C 5: 21,305,528 H527R probably benign Het
Cd226 A G 18: 89,207,327 N116S probably benign Het
Cit A G 5: 115,987,046 K1612E probably damaging Het
Cmtr1 T A 17: 29,681,980 Y663* probably null Het
Col3a1 T A 1: 45,337,512 probably benign Het
Copa A G 1: 172,119,901 N1095D probably benign Het
Cpne1 G T 2: 156,073,971 A433E probably damaging Het
Cyfip1 C T 7: 55,928,284 L1181F probably damaging Het
Dnajc6 T A 4: 101,612,930 I220N probably damaging Het
Duxbl1 G C 14: 25,987,748 probably benign Het
Fam135b C T 15: 71,463,911 R478H probably benign Het
Fam91a1 T A 15: 58,450,600 S734T possibly damaging Het
Fut10 T G 8: 31,236,467 S417A probably benign Het
Gm9945 C T 11: 53,480,336 probably benign Het
Golga4 A G 9: 118,556,612 E934G probably damaging Het
Gpat2 G A 2: 127,428,291 V75M probably damaging Het
Hdac5 A G 11: 102,197,136 V949A probably damaging Het
Hdgfl1 G T 13: 26,769,749 L114I probably benign Het
Ifi27l2b T A 12: 103,455,824 M94L unknown Het
Irs2 C A 8: 11,005,352 A1027S probably benign Het
Itga2 A T 13: 114,881,042 C111S probably damaging Het
Khdrbs1 T C 4: 129,720,747 T338A probably benign Het
Klk1 T C 7: 44,220,737 probably null Het
Kmt2b T C 7: 30,576,068 N1822S probably benign Het
Lrig3 T C 10: 125,994,441 I136T probably benign Het
Lyar T A 5: 38,227,932 D105E probably benign Het
Mat1a T A 14: 41,122,512 D366E probably benign Het
Mrc2 G A 11: 105,348,431 probably null Het
Naip1 A T 13: 100,423,219 D1092E probably benign Het
Neb T A 2: 52,249,511 K95* probably null Het
Nectin4 A G 1: 171,380,208 D56G probably benign Het
Nupl1 A T 14: 60,232,660 F334Y probably damaging Het
Olfr1502 A G 19: 13,862,309 N172S probably damaging Het
Olfr294 A T 7: 86,616,187 F153I probably benign Het
Pde8a C A 7: 81,317,422 T437K probably benign Het
Ppp1r3a A T 6: 14,719,378 N512K possibly damaging Het
Pqlc2 A G 4: 139,302,499 F74L probably damaging Het
Pramef8 A G 4: 143,417,903 Q273R possibly damaging Het
Rad51ap2 A G 12: 11,457,067 D330G probably damaging Het
Ren1 G A 1: 133,360,124 A399T probably damaging Het
Rnft2 G T 5: 118,194,605 probably benign Het
Sept14 A T 5: 129,699,035 S27T probably benign Het
Shox2 T C 3: 66,978,359 K128E possibly damaging Het
Skint1 T C 4: 112,025,481 W241R probably benign Het
Slc24a4 T A 12: 102,222,051 H134Q probably benign Het
Slc25a36 A T 9: 97,079,071 L165Q possibly damaging Het
Slc35f1 A G 10: 53,073,534 I240V probably benign Het
Tab2 G A 10: 7,907,481 P679L probably damaging Het
Tarbp2 A G 15: 102,518,557 E3G possibly damaging Het
Tas2r130 A T 6: 131,630,073 I253K probably damaging Het
Timm44 A C 8: 4,266,588 C319G probably null Het
Tjap1 A T 17: 46,260,095 N165K probably damaging Het
Tmem63b A G 17: 45,666,154 I429T probably benign Het
Trabd2b A T 4: 114,599,903 D339V probably damaging Het
Tst T C 15: 78,405,833 M1V probably null Het
Ube4a A T 9: 44,948,137 N335K probably benign Het
Vps54 C T 11: 21,306,394 T633M probably benign Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp953 A G 13: 67,347,939 Y13H probably damaging Het
Other mutations in Adam18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Adam18 APN 8 24628133 missense probably damaging 1.00
IGL01649:Adam18 APN 8 24614896 missense possibly damaging 0.82
IGL02212:Adam18 APN 8 24637179 missense probably benign 0.02
IGL02455:Adam18 APN 8 24651848 missense probably damaging 0.96
IGL02525:Adam18 APN 8 24611044 missense probably benign 0.00
IGL02525:Adam18 APN 8 24641767 splice site probably benign
IGL02966:Adam18 APN 8 24611149 splice site probably benign
IGL03136:Adam18 APN 8 24641836 missense probably damaging 1.00
G5030:Adam18 UTSW 8 24651856 missense probably benign 0.24
R0135:Adam18 UTSW 8 24665542 missense possibly damaging 0.71
R0280:Adam18 UTSW 8 24674054 missense probably benign 0.06
R0389:Adam18 UTSW 8 24629637 splice site probably null
R0390:Adam18 UTSW 8 24674054 missense probably benign 0.06
R0443:Adam18 UTSW 8 24629637 splice site probably null
R0479:Adam18 UTSW 8 24651822 missense probably benign
R0578:Adam18 UTSW 8 24641847 missense possibly damaging 0.82
R0645:Adam18 UTSW 8 24672120 nonsense probably null
R0881:Adam18 UTSW 8 24672143 splice site probably benign
R0885:Adam18 UTSW 8 24651786 missense probably damaging 1.00
R0973:Adam18 UTSW 8 24647853 missense probably benign 0.01
R0973:Adam18 UTSW 8 24647853 missense probably benign 0.01
R0974:Adam18 UTSW 8 24647853 missense probably benign 0.01
R1005:Adam18 UTSW 8 24665514 missense probably benign 0.05
R1356:Adam18 UTSW 8 24668595 splice site probably benign
R1510:Adam18 UTSW 8 24625831 missense probably benign 0.01
R1552:Adam18 UTSW 8 24646361 missense probably benign
R1568:Adam18 UTSW 8 24647783 splice site probably null
R1639:Adam18 UTSW 8 24652152 missense probably benign 0.00
R1968:Adam18 UTSW 8 24646447 missense probably benign 0.32
R2029:Adam18 UTSW 8 24650877 missense probably damaging 1.00
R2058:Adam18 UTSW 8 24672066 splice site probably benign
R2211:Adam18 UTSW 8 24628155 missense probably damaging 0.96
R2237:Adam18 UTSW 8 24646287 missense probably benign 0.01
R2238:Adam18 UTSW 8 24646287 missense probably benign 0.01
R2239:Adam18 UTSW 8 24646287 missense probably benign 0.01
R3122:Adam18 UTSW 8 24628232 missense possibly damaging 0.74
R3426:Adam18 UTSW 8 24667604 missense probably damaging 1.00
R3428:Adam18 UTSW 8 24667604 missense probably damaging 1.00
R3967:Adam18 UTSW 8 24629710 missense probably benign 0.12
R4833:Adam18 UTSW 8 24674101 missense probably benign 0.01
R4965:Adam18 UTSW 8 24641811 missense probably damaging 1.00
R5249:Adam18 UTSW 8 24625852 missense probably benign 0.00
R5534:Adam18 UTSW 8 24665514 missense probably benign 0.05
R5920:Adam18 UTSW 8 24674075 missense probably damaging 1.00
R6329:Adam18 UTSW 8 24614827 missense probably damaging 1.00
R6450:Adam18 UTSW 8 24629675 missense probably benign 0.05
R6479:Adam18 UTSW 8 24629665 missense probably benign 0.29
R6516:Adam18 UTSW 8 24674687 missense probably damaging 1.00
R6603:Adam18 UTSW 8 24665502 missense possibly damaging 0.63
R7194:Adam18 UTSW 8 24651852 missense possibly damaging 0.67
R7226:Adam18 UTSW 8 24647808 missense probably damaging 1.00
R7266:Adam18 UTSW 8 24667623 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGTGTGACCCAGACTCTTCC -3'
(R):5'- AAATCTCTTAGCCCCTCAATTAGC -3'

Sequencing Primer
(F):5'- CTCATCGAGGCTCTAGGGTAG -3'
(R):5'- TTAGCCACAACCAGCCATGTTTAG -3'
Posted On2014-12-04