Incidental Mutation 'R2762:Prkcq'
ID254076
Institutional Source Beutler Lab
Gene Symbol Prkcq
Ensembl Gene ENSMUSG00000026778
Gene Nameprotein kinase C, theta
SynonymsPKC theta, PKC-0, PKCtheta, PKC-theta, A130035A12Rik, Pkcq
Accession Numbers

Genbank: NM_008859; MGI: 97601

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2762 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location11172108-11301222 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11232640 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 77 (K77E)
Ref Sequence ENSEMBL: ENSMUSP00000028118 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028118] [ENSMUST00000102970]
PDB Structure
Identification of the Activator Binding Residues in the Second Cysteine-Rich Regulatory Domain of Protein Kinase C Theta [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028118
AA Change: K77E

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000028118
Gene: ENSMUSG00000026778
AA Change: K77E

DomainStartEndE-ValueType
PDB:2ENJ|A 3 126 6e-83 PDB
C1 160 209 3.27e-15 SMART
C1 232 281 2.22e-17 SMART
S_TKc 380 634 1.17e-97 SMART
S_TK_X 635 698 2.6e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102970
AA Change: K77E

PolyPhen 2 Score 0.353 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000100035
Gene: ENSMUSG00000026778
AA Change: K77E

DomainStartEndE-ValueType
PDB:2ENJ|A 3 126 2e-84 PDB
C1 160 209 3.27e-15 SMART
C1 232 281 2.22e-17 SMART
Pfam:Pkinase_Tyr 380 558 2.8e-27 PFAM
Pfam:Pkinase 380 560 2.2e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114853
SMART Domains Protein: ENSMUSP00000110503
Gene: ENSMUSG00000026778

DomainStartEndE-ValueType
PDB:2ENJ|A 3 126 9e-86 PDB
Blast:C2 6 101 2e-44 BLAST
C1 160 209 3.27e-15 SMART
C1 232 281 2.22e-17 SMART
Pfam:Pkinase 380 465 1.7e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192244
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195207
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role. The protein encoded by this gene is one of the PKC family members. It is a calcium-independent and phospholipid-dependent protein kinase. This kinase is important for T-cell activation. It is required for the activation of the transcription factors NF-kappaB and AP-1, and may link the T cell receptor (TCR) signaling complex to the activation of the transcription factors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced T cell proliferative responses and interleukin 2 production and a lack of T cell receptor-initiated NF-kappaB activation in mature T lymphocytes. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(2) Targeted, other(1)

Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak2 T A 12: 112,785,364 T288S probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Baiap3 A G 17: 25,244,575 L909P probably damaging Het
Bicd1 C T 6: 149,520,403 A874V probably damaging Het
Dusp3 T C 11: 101,974,835 T178A probably benign Het
En2 T C 5: 28,170,421 S321P probably damaging Het
Ext1 G A 15: 53,344,927 S146L probably benign Het
Gm9923 C A 10: 72,309,630 H104N probably benign Het
Igtp A G 11: 58,206,065 M21V possibly damaging Het
Irs2 T C 8: 11,006,408 S675G probably damaging Het
Klhl36 T A 8: 119,869,974 L138Q probably damaging Het
Kmt2d T C 15: 98,852,055 probably benign Het
Nox3 A G 17: 3,696,158 V35A probably benign Het
Osbpl1a T C 18: 12,766,899 D274G possibly damaging Het
Plec C T 15: 76,172,286 G4349S probably damaging Het
Ppip5k2 A C 1: 97,717,509 S1073R probably damaging Het
Prss1 T C 6: 41,463,281 V184A possibly damaging Het
Rnf111 T A 9: 70,476,045 H202L possibly damaging Het
S100pbp G A 4: 129,155,426 R308* probably null Het
Sgcb A T 5: 73,635,709 probably null Het
Spam1 T C 6: 24,796,643 F198L possibly damaging Het
Tbc1d4 A C 14: 101,494,361 C472G probably damaging Het
Tonsl T C 15: 76,630,620 N1128S probably damaging Het
Ttn C T 2: 76,798,103 R14571Q probably damaging Het
Tubb4a T A 17: 57,080,974 T351S probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Wasl T C 6: 24,619,501 Y340C unknown Het
Other mutations in Prkcq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01654:Prkcq APN 2 11283843 missense probably damaging 1.00
IGL01656:Prkcq APN 2 11226955 missense probably damaging 1.00
IGL01732:Prkcq APN 2 11260833 splice site probably benign
IGL02136:Prkcq APN 2 11260668 missense probably benign 0.00
IGL02161:Prkcq APN 2 11277076 missense probably benign
IGL02178:Prkcq APN 2 11277040 missense possibly damaging 0.93
IGL03107:Prkcq APN 2 11260786 missense probably damaging 1.00
IGL03149:Prkcq APN 2 11232545 missense probably benign 0.11
celina UTSW 2 11283849 missense possibly damaging 0.82
celina2 UTSW 2 11226986 critical splice donor site probably null
3-1:Prkcq UTSW 2 11300094 missense probably damaging 1.00
K3955:Prkcq UTSW 2 11246793 splice site probably benign
R0049:Prkcq UTSW 2 11283832 missense probably benign 0.04
R0049:Prkcq UTSW 2 11283832 missense probably benign 0.04
R0183:Prkcq UTSW 2 11253162 missense probably damaging 1.00
R0366:Prkcq UTSW 2 11246838 splice site probably benign
R0388:Prkcq UTSW 2 11254234 missense probably benign
R1385:Prkcq UTSW 2 11256286 missense probably damaging 1.00
R1687:Prkcq UTSW 2 11290533 missense probably damaging 1.00
R1693:Prkcq UTSW 2 11254199 missense probably damaging 0.99
R1760:Prkcq UTSW 2 11300070 missense probably damaging 1.00
R1764:Prkcq UTSW 2 11232631 missense probably damaging 1.00
R1968:Prkcq UTSW 2 11245397 missense probably damaging 1.00
R2020:Prkcq UTSW 2 11279521 missense probably benign
R2108:Prkcq UTSW 2 11232569 missense probably damaging 1.00
R3402:Prkcq UTSW 2 11283849 missense possibly damaging 0.82
R3429:Prkcq UTSW 2 11246970 missense probably damaging 1.00
R3545:Prkcq UTSW 2 11283816 missense probably benign 0.11
R3547:Prkcq UTSW 2 11283816 missense probably benign 0.11
R3893:Prkcq UTSW 2 11226971 missense probably damaging 1.00
R4086:Prkcq UTSW 2 11283868 missense probably damaging 0.97
R4423:Prkcq UTSW 2 11256169 missense possibly damaging 0.66
R4541:Prkcq UTSW 2 11283812 missense possibly damaging 0.84
R4649:Prkcq UTSW 2 11279522 missense possibly damaging 0.83
R4652:Prkcq UTSW 2 11279522 missense possibly damaging 0.83
R4820:Prkcq UTSW 2 11226986 critical splice donor site probably null
R5197:Prkcq UTSW 2 11299416 missense probably damaging 1.00
R6008:Prkcq UTSW 2 11256286 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGAGCCCACTATTAAATGGAATTG -3'
(R):5'- TAGCTAGCATCATGGTGCAC -3'

Sequencing Primer
(F):5'- GGCAGATGTACATCCAGA -3'
(R):5'- ATCATGGTGCACACTAGCTG -3'
Posted On2014-12-04