Incidental Mutation 'R2762:S100pbp'
ID254080
Institutional Source Beutler Lab
Gene Symbol S100pbp
Ensembl Gene ENSMUSG00000040928
Gene NameS100P binding protein
Synonyms4930429A08Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R2762 (G1)
Quality Score195
Status Not validated
Chromosome4
Chromosomal Location129148005-129189727 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 129155426 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 308 (R308*)
Ref Sequence ENSEMBL: ENSMUSP00000113920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049081] [ENSMUST00000072431] [ENSMUST00000106059] [ENSMUST00000106061] [ENSMUST00000117497] [ENSMUST00000117965]
Predicted Effect probably null
Transcript: ENSMUST00000049081
AA Change: R350*
SMART Domains Protein: ENSMUSP00000039820
Gene: ENSMUSG00000040928
AA Change: R350*

DomainStartEndE-ValueType
Pfam:S100PBPR 21 382 4.4e-194 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000072431
AA Change: R272*
SMART Domains Protein: ENSMUSP00000072258
Gene: ENSMUSG00000040928
AA Change: R272*

DomainStartEndE-ValueType
Pfam:S100PBPR 21 108 1.6e-36 PFAM
Pfam:S100PBPR 107 162 2.1e-17 PFAM
Pfam:S100PBPR 153 304 6.6e-87 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106059
AA Change: R231*
SMART Domains Protein: ENSMUSP00000101674
Gene: ENSMUSG00000040928
AA Change: R231*

DomainStartEndE-ValueType
Pfam:S100PBPR 21 67 1.2e-23 PFAM
Pfam:S100PBPR 66 121 1.1e-17 PFAM
Pfam:S100PBPR 112 263 4.9e-87 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000106061
AA Change: R350*
SMART Domains Protein: ENSMUSP00000101676
Gene: ENSMUSG00000040928
AA Change: R350*

DomainStartEndE-ValueType
Pfam:S100PBPR 21 382 8.5e-193 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000117497
AA Change: R308*
SMART Domains Protein: ENSMUSP00000113084
Gene: ENSMUSG00000040928
AA Change: R308*

DomainStartEndE-ValueType
Pfam:S100PBPR 21 198 2.4e-83 PFAM
Pfam:S100PBPR 189 327 1.1e-77 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000117965
AA Change: R308*
SMART Domains Protein: ENSMUSP00000113920
Gene: ENSMUSG00000040928
AA Change: R308*

DomainStartEndE-ValueType
Pfam:S100PBPR 21 198 2.4e-83 PFAM
Pfam:S100PBPR 189 327 1.1e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148920
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151971
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that was originally identified by its interaction with S100 calcium-binding protein P. Expression of this protein has been reported to be associated with pancreatic ductal adenocarcinoma. Alternatively spliced transcript variants have been described. [provided by RefSeq, Jan 2012]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak2 T A 12: 112,785,364 T288S probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Baiap3 A G 17: 25,244,575 L909P probably damaging Het
Bicd1 C T 6: 149,520,403 A874V probably damaging Het
Dusp3 T C 11: 101,974,835 T178A probably benign Het
En2 T C 5: 28,170,421 S321P probably damaging Het
Ext1 G A 15: 53,344,927 S146L probably benign Het
Gm9923 C A 10: 72,309,630 H104N probably benign Het
Igtp A G 11: 58,206,065 M21V possibly damaging Het
Irs2 T C 8: 11,006,408 S675G probably damaging Het
Klhl36 T A 8: 119,869,974 L138Q probably damaging Het
Kmt2d T C 15: 98,852,055 probably benign Het
Nox3 A G 17: 3,696,158 V35A probably benign Het
Osbpl1a T C 18: 12,766,899 D274G possibly damaging Het
Plec C T 15: 76,172,286 G4349S probably damaging Het
Ppip5k2 A C 1: 97,717,509 S1073R probably damaging Het
Prkcq A G 2: 11,232,640 K77E possibly damaging Het
Prss1 T C 6: 41,463,281 V184A possibly damaging Het
Rnf111 T A 9: 70,476,045 H202L possibly damaging Het
Sgcb A T 5: 73,635,709 probably null Het
Spam1 T C 6: 24,796,643 F198L possibly damaging Het
Tbc1d4 A C 14: 101,494,361 C472G probably damaging Het
Tonsl T C 15: 76,630,620 N1128S probably damaging Het
Ttn C T 2: 76,798,103 R14571Q probably damaging Het
Tubb4a T A 17: 57,080,974 T351S probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Wasl T C 6: 24,619,501 Y340C unknown Het
Other mutations in S100pbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:S100pbp APN 4 129182108 missense possibly damaging 0.94
IGL02302:S100pbp APN 4 129182441 missense probably damaging 1.00
IGL02554:S100pbp APN 4 129181851 splice site probably null
R0068:S100pbp UTSW 4 129144456 unclassified probably benign
R1720:S100pbp UTSW 4 129182093 missense probably damaging 1.00
R2058:S100pbp UTSW 4 129182100 missense probably benign 0.02
R2415:S100pbp UTSW 4 129181821 missense possibly damaging 0.67
R4815:S100pbp UTSW 4 129150933 unclassified probably benign
R5537:S100pbp UTSW 4 129182188 missense probably benign 0.39
R7113:S100pbp UTSW 4 129182103 missense probably damaging 0.96
R7384:S100pbp UTSW 4 129181909 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CATACAGCTAGTTAAACACTGTGC -3'
(R):5'- TGGTTGACTGTGATACCCGC -3'

Sequencing Primer
(F):5'- CACTGTGCATCTAATATTAGAACCTG -3'
(R):5'- ATACCCGCGTCAGGTATTATCAGG -3'
Posted On2014-12-04