Incidental Mutation 'R2762:Irs2'
ID254096
Institutional Source Beutler Lab
Gene Symbol Irs2
Ensembl Gene ENSMUSG00000038894
Gene Nameinsulin receptor substrate 2
SynonymsIrs-2
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.502) question?
Stock #R2762 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location10984681-11008458 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11006408 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 675 (S675G)
Ref Sequence ENSEMBL: ENSMUSP00000038514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040514]
PDB Structure
Crystal structure of the insulin receptor kinase in complex with IRS2 KRLB peptide [X-RAY DIFFRACTION]
Crystal structure of the insulin receptor kinase in complex with IRS2 KRLB peptide and ATP [X-RAY DIFFRACTION]
Crystal structure of the insulin receptor kinase in complex with IRS2 KRLB phosphopeptide [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000040514
AA Change: S675G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038514
Gene: ENSMUSG00000038894
AA Change: S675G

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 19 28 N/A INTRINSIC
PH 31 146 2.83e-13 SMART
IRS 191 293 4.98e-38 SMART
PTBI 191 293 2.24e-51 SMART
low complexity region 301 309 N/A INTRINSIC
low complexity region 364 377 N/A INTRINSIC
low complexity region 435 473 N/A INTRINSIC
low complexity region 478 490 N/A INTRINSIC
low complexity region 688 710 N/A INTRINSIC
low complexity region 721 730 N/A INTRINSIC
low complexity region 834 846 N/A INTRINSIC
low complexity region 923 959 N/A INTRINSIC
low complexity region 976 984 N/A INTRINSIC
low complexity region 997 1028 N/A INTRINSIC
low complexity region 1137 1154 N/A INTRINSIC
low complexity region 1191 1208 N/A INTRINSIC
low complexity region 1274 1296 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180750
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the insulin receptor substrate 2, a cytoplasmic signaling molecule that mediates effects of insulin, insulin-like growth factor 1, and other cytokines by acting as a molecular adaptor between diverse receptor tyrosine kinases and downstream effectors. The product of this gene is phosphorylated by the insulin receptor tyrosine kinase upon receptor stimulation, as well as by an interleukin 4 receptor-associated kinase in response to IL4 treatment. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene results in type 2 diabetes due to insulin resistance and pancreatic beta cell dysfunction, causes defects in leptin action, energy balance, lipid homeostasis and vascular wound healing, and leads to female infertility due to hypothalamic and ovarian dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak2 T A 12: 112,785,364 T288S probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Baiap3 A G 17: 25,244,575 L909P probably damaging Het
Bicd1 C T 6: 149,520,403 A874V probably damaging Het
Dusp3 T C 11: 101,974,835 T178A probably benign Het
En2 T C 5: 28,170,421 S321P probably damaging Het
Ext1 G A 15: 53,344,927 S146L probably benign Het
Gm9923 C A 10: 72,309,630 H104N probably benign Het
Igtp A G 11: 58,206,065 M21V possibly damaging Het
Klhl36 T A 8: 119,869,974 L138Q probably damaging Het
Kmt2d T C 15: 98,852,055 probably benign Het
Nox3 A G 17: 3,696,158 V35A probably benign Het
Osbpl1a T C 18: 12,766,899 D274G possibly damaging Het
Plec C T 15: 76,172,286 G4349S probably damaging Het
Ppip5k2 A C 1: 97,717,509 S1073R probably damaging Het
Prkcq A G 2: 11,232,640 K77E possibly damaging Het
Prss1 T C 6: 41,463,281 V184A possibly damaging Het
Rnf111 T A 9: 70,476,045 H202L possibly damaging Het
S100pbp G A 4: 129,155,426 R308* probably null Het
Sgcb A T 5: 73,635,709 probably null Het
Spam1 T C 6: 24,796,643 F198L possibly damaging Het
Tbc1d4 A C 14: 101,494,361 C472G probably damaging Het
Tonsl T C 15: 76,630,620 N1128S probably damaging Het
Ttn C T 2: 76,798,103 R14571Q probably damaging Het
Tubb4a T A 17: 57,080,974 T351S probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Wasl T C 6: 24,619,501 Y340C unknown Het
Other mutations in Irs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Irs2 APN 8 11005867 missense probably benign 0.00
IGL01328:Irs2 APN 8 11004792 missense probably damaging 0.99
IGL01875:Irs2 APN 8 11006221 missense probably damaging 0.98
IGL02444:Irs2 APN 8 11006306 missense probably benign 0.03
IGL02448:Irs2 APN 8 11007862 missense probably benign 0.21
IGL02945:Irs2 APN 8 11007781 missense probably damaging 1.00
IGL03068:Irs2 APN 8 11004974 missense probably damaging 0.99
Dum_dum UTSW 8 10987012 makesense probably null
R0062:Irs2 UTSW 8 11005723 missense possibly damaging 0.65
R0062:Irs2 UTSW 8 11005723 missense possibly damaging 0.65
R0107:Irs2 UTSW 8 11004691 missense probably damaging 1.00
R0147:Irs2 UTSW 8 11007568 missense probably damaging 1.00
R0501:Irs2 UTSW 8 11006396 missense probably damaging 1.00
R0565:Irs2 UTSW 8 11004592 missense probably damaging 0.98
R2042:Irs2 UTSW 8 11007580 missense probably damaging 0.99
R2268:Irs2 UTSW 8 11007586 missense probably damaging 0.98
R2518:Irs2 UTSW 8 11005352 missense probably benign 0.00
R3623:Irs2 UTSW 8 11007643 missense probably damaging 1.00
R3624:Irs2 UTSW 8 11007643 missense probably damaging 1.00
R5022:Irs2 UTSW 8 10987012 makesense probably null
R5270:Irs2 UTSW 8 11006678 nonsense probably null
R5377:Irs2 UTSW 8 11005277 missense probably benign 0.00
R5604:Irs2 UTSW 8 11005007 missense possibly damaging 0.84
R6049:Irs2 UTSW 8 11006805 missense probably benign 0.01
R6219:Irs2 UTSW 8 11005121 missense probably damaging 0.99
R6654:Irs2 UTSW 8 11006486 missense probably damaging 1.00
R6726:Irs2 UTSW 8 11004961 missense possibly damaging 0.86
R6813:Irs2 UTSW 8 11004659 nonsense probably null
R6934:Irs2 UTSW 8 11004697 missense probably damaging 0.99
R7261:Irs2 UTSW 8 11007018 missense possibly damaging 0.95
R7285:Irs2 UTSW 8 11006797 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CATGTACCCACTGTCTTCTGGG -3'
(R):5'- TCTCTGGTAGTTCAGGTCGC -3'

Sequencing Primer
(F):5'- CACTGTCTTCTGGGGAGCTC -3'
(R):5'- GTAGTTCAGGTCGCCTCTGC -3'
Posted On2014-12-04