Incidental Mutation 'R2762:Gm9923'
ID254106
Institutional Source Beutler Lab
Gene Symbol Gm9923
Ensembl Gene ENSMUSG00000053830
Gene Namepredicted pseudogene 9923
Synonyms
Accession Numbers
Is this an essential gene? Not available question?
Stock #R2762 (G1)
Quality Score179
Status Not validated
Chromosome10
Chromosomal Location72309225-72311848 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 72309630 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 104 (H104N)
Ref Sequence ENSEMBL: ENSMUSP00000135902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061324]
Predicted Effect probably benign
Transcript: ENSMUST00000061324
AA Change: H104N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000135902
Gene: ENSMUSG00000019977
AA Change: H104N

DomainStartEndE-ValueType
Pfam:HBS1_N 10 125 1.5e-22 PFAM
low complexity region 311 331 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217785
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak2 T A 12: 112,785,364 T288S probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Baiap3 A G 17: 25,244,575 L909P probably damaging Het
Bicd1 C T 6: 149,520,403 A874V probably damaging Het
Dusp3 T C 11: 101,974,835 T178A probably benign Het
En2 T C 5: 28,170,421 S321P probably damaging Het
Ext1 G A 15: 53,344,927 S146L probably benign Het
Igtp A G 11: 58,206,065 M21V possibly damaging Het
Irs2 T C 8: 11,006,408 S675G probably damaging Het
Klhl36 T A 8: 119,869,974 L138Q probably damaging Het
Kmt2d T C 15: 98,852,055 probably benign Het
Nox3 A G 17: 3,696,158 V35A probably benign Het
Osbpl1a T C 18: 12,766,899 D274G possibly damaging Het
Plec C T 15: 76,172,286 G4349S probably damaging Het
Ppip5k2 A C 1: 97,717,509 S1073R probably damaging Het
Prkcq A G 2: 11,232,640 K77E possibly damaging Het
Prss1 T C 6: 41,463,281 V184A possibly damaging Het
Rnf111 T A 9: 70,476,045 H202L possibly damaging Het
S100pbp G A 4: 129,155,426 R308* probably null Het
Sgcb A T 5: 73,635,709 probably null Het
Spam1 T C 6: 24,796,643 F198L possibly damaging Het
Tbc1d4 A C 14: 101,494,361 C472G probably damaging Het
Tonsl T C 15: 76,630,620 N1128S probably damaging Het
Ttn C T 2: 76,798,103 R14571Q probably damaging Het
Tubb4a T A 17: 57,080,974 T351S probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Wasl T C 6: 24,619,501 Y340C unknown Het
Other mutations in Gm9923
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1797:Gm9923 UTSW 10 72309763 missense probably benign 0.18
R1956:Gm9923 UTSW 10 72309660 missense probably benign 0.01
R2764:Gm9923 UTSW 10 72309630 missense probably benign 0.00
R4684:Gm9923 UTSW 10 72309476 nonsense probably null
R4729:Gm9923 UTSW 10 72309694 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGTTCATTTACTCACGCCGTG -3'
(R):5'- TCAAAAGGTTTGCTACTGCTATCC -3'

Sequencing Primer
(F):5'- TTTACTCACGCCGTGACAAC -3'
(R):5'- GGTTTGCTACTGCTATCCAAATG -3'
Posted On2014-12-04