Incidental Mutation 'R2519:Fmo3'
ID254143
Institutional Source Beutler Lab
Gene Symbol Fmo3
Ensembl Gene ENSMUSG00000026691
Gene Nameflavin containing monooxygenase 3
Synonyms
MMRRC Submission 040423-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.046) question?
Stock #R2519 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location162953800-162984528 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 162958305 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 372 (V372D)
Ref Sequence ENSEMBL: ENSMUSP00000028010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028010]
Predicted Effect probably damaging
Transcript: ENSMUST00000028010
AA Change: V372D

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028010
Gene: ENSMUSG00000026691
AA Change: V372D

DomainStartEndE-ValueType
Pfam:FMO-like 2 534 7.7e-286 PFAM
Pfam:Pyr_redox_2 3 245 4.4e-15 PFAM
Pfam:Pyr_redox_3 6 220 1.1e-11 PFAM
Pfam:NAD_binding_8 7 71 3.1e-7 PFAM
Pfam:K_oxygenase 79 224 6.7e-9 PFAM
Meta Mutation Damage Score 0.436 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (72/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Flavin-containing monooxygenases (FMO) are an important class of drug-metabolizing enzymes that catalyze the NADPH-dependent oxygenation of various nitrogen-,sulfur-, and phosphorous-containing xenobiotics such as therapeutic drugs, dietary compounds, pesticides, and other foreign compounds. The human FMO gene family is composed of 5 genes and multiple pseudogenes. FMO members have distinct developmental- and tissue-specific expression patterns. The expression of this FMO3 gene, the major FMO expressed in adult liver, can vary up to 20-fold between individuals. This inter-individual variation in FMO3 expression levels is likely to have significant effects on the rate at which xenobiotics are metabolised and, therefore, is of considerable interest to the pharmaceutical industry. This transmembrane protein localizes to the endoplasmic reticulum of many tissues. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. Mutations in this gene cause the disorder trimethylaminuria (TMAu) which is characterized by the accumulation and excretion of unmetabolized trimethylamine and a distinctive body odor. In healthy individuals, trimethylamine is primarily converted to the non odorous trimethylamine N-oxide.[provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933408J17Rik G A 10: 93,589,588 probably benign Het
Actn1 A T 12: 80,192,389 H247Q probably damaging Het
Adgre1 T C 17: 57,410,956 C323R probably damaging Het
Adgrf2 T A 17: 42,710,407 I509F probably damaging Het
Aknad1 A T 3: 108,756,468 T331S probably damaging Het
Aldh1a3 T C 7: 66,422,299 D39G probably benign Het
Alms1 C A 6: 85,667,963 probably benign Het
Ankhd1 T G 18: 36,578,543 probably null Het
Arfgef2 T C 2: 166,881,244 S1535P probably benign Het
BC027072 C T 17: 71,751,647 S345N probably damaging Het
Bicc1 T C 10: 70,930,644 E916G probably damaging Het
Birc2 A T 9: 7,821,179 D381E possibly damaging Het
Btbd11 T A 10: 85,651,611 V981D probably damaging Het
Carnmt1 A G 19: 18,693,711 I316V probably benign Het
Chd6 T A 2: 161,029,876 Y213F possibly damaging Het
Coq7 A T 7: 118,510,148 W226R unknown Het
Cyp2d9 G A 15: 82,454,518 probably null Het
Ddx42 T A 11: 106,245,329 N635K probably damaging Het
Dmtf1 T C 5: 9,129,323 T292A possibly damaging Het
Dnajb8 T C 6: 88,222,875 V131A probably benign Het
Dock6 T C 9: 21,816,333 E1367G possibly damaging Het
Dvl1 T A 4: 155,855,543 Y377* probably null Het
Eif4g3 T A 4: 138,097,318 F278Y probably benign Het
Fancg A T 4: 43,008,787 L150H probably damaging Het
Fastkd5 T C 2: 130,616,194 T159A possibly damaging Het
Fkrp G T 7: 16,810,952 Y328* probably null Het
Gm10639 T G 9: 78,304,439 L161R probably damaging Het
Gm12184 A G 11: 48,826,123 I76T probably damaging Het
Gm5065 A T 7: 5,359,834 I155F probably damaging Het
Gtf2h4 C A 17: 35,670,909 G143W probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hmcn1 A T 1: 150,773,820 Y638* probably null Het
Ighv11-2 T A 12: 114,048,292 Q101L probably damaging Het
Lipf G T 19: 33,965,525 V78L probably damaging Het
Magi3 T C 3: 104,015,765 E1212G probably benign Het
Mfap5 T C 6: 122,525,989 S75P probably damaging Het
Mn1 C A 5: 111,418,552 H129Q possibly damaging Het
Morc3 A G 16: 93,862,539 probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Myo5c A G 9: 75,250,436 I224V probably damaging Het
Nupl1 T C 14: 60,223,359 T486A probably benign Het
Olfr1026 A G 2: 85,923,607 Y113C probably damaging Het
Olfr910 T A 9: 38,538,985 V30D probably damaging Het
Parp14 A T 16: 35,858,203 L465Q possibly damaging Het
Plcd3 A T 11: 103,080,400 I110N possibly damaging Het
Prx A G 7: 27,518,243 E862G probably benign Het
Rad50 G A 11: 53,707,185 probably benign Het
Rbm15 A G 3: 107,330,833 S750P probably benign Het
Reln C A 5: 22,344,369 A14S unknown Het
Rph3a T C 5: 120,954,422 Y372C probably damaging Het
Serpine2 T A 1: 79,799,539 H187L possibly damaging Het
Slc11a2 T C 15: 100,401,323 D122G probably damaging Het
Slc25a32 A T 15: 39,096,055 V289E probably damaging Het
Slc25a46 A T 18: 31,602,761 S142T probably benign Het
Srm A G 4: 148,591,504 probably null Het
Srsf5 A G 12: 80,949,096 D123G probably damaging Het
Stab1 A T 14: 31,154,872 C832S probably damaging Het
Stab2 A C 10: 86,934,840 probably benign Het
Suds3 T C 5: 117,094,953 N282S probably damaging Het
Taar9 A T 10: 24,109,254 V94E probably damaging Het
Taf2 C A 15: 55,052,247 A428S probably benign Het
Tbk1 G T 10: 121,557,259 T462K probably benign Het
Tcaf2 T G 6: 42,629,431 I530L possibly damaging Het
Tigd4 A G 3: 84,593,914 Y46C probably damaging Het
Topors G T 4: 40,261,714 Y523* probably null Het
Tpte T C 8: 22,333,160 probably benign Het
Trpv5 T A 6: 41,674,350 Q254L probably damaging Het
Trpv6 G A 6: 41,624,616 Q457* probably null Het
Ush2a A T 1: 188,267,107 M205L probably benign Het
Vmn1r90 A T 7: 14,561,718 Y152N probably damaging Het
Vmn2r124 T A 17: 18,074,018 V789D probably damaging Het
Vmn2r99 T C 17: 19,378,708 I218T probably damaging Het
Vstm2b T C 7: 40,902,875 V248A probably benign Het
Wnk2 T C 13: 49,071,029 K1019E probably damaging Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp229 T A 17: 21,745,587 F266Y possibly damaging Het
Zfp616 T A 11: 74,084,268 C454* probably null Het
Other mutations in Fmo3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Fmo3 APN 1 162964030 missense probably benign 0.15
IGL01124:Fmo3 APN 1 162958261 missense probably damaging 1.00
IGL01645:Fmo3 APN 1 162964006 missense possibly damaging 0.53
IGL01710:Fmo3 APN 1 162983043 missense probably damaging 1.00
IGL01943:Fmo3 APN 1 162967006 missense probably benign 0.01
IGL02489:Fmo3 APN 1 162954287 missense possibly damaging 0.75
IGL02503:Fmo3 APN 1 162968864 missense probably benign 0.03
IGL02743:Fmo3 APN 1 162958483 missense probably damaging 1.00
IGL02974:Fmo3 APN 1 162983050 missense probably damaging 1.00
IGL03023:Fmo3 APN 1 162958465 missense probably benign 0.00
R0554:Fmo3 UTSW 1 162954332 missense probably benign 0.03
R0629:Fmo3 UTSW 1 162958227 splice site probably benign
R1209:Fmo3 UTSW 1 162964028 missense probably benign 0.00
R1213:Fmo3 UTSW 1 162967823 missense probably damaging 1.00
R1612:Fmo3 UTSW 1 162967885 missense probably damaging 1.00
R1636:Fmo3 UTSW 1 162954425 missense probably benign
R1710:Fmo3 UTSW 1 162967787 missense possibly damaging 0.59
R1764:Fmo3 UTSW 1 162958573 missense possibly damaging 0.79
R1775:Fmo3 UTSW 1 162968725 missense possibly damaging 0.54
R1906:Fmo3 UTSW 1 162966906 missense probably damaging 1.00
R2363:Fmo3 UTSW 1 162954315 missense probably damaging 0.98
R2418:Fmo3 UTSW 1 162966958 missense probably benign
R3940:Fmo3 UTSW 1 162963986 missense probably benign 0.01
R3977:Fmo3 UTSW 1 162958578 missense probably damaging 0.99
R4779:Fmo3 UTSW 1 162968838 missense probably damaging 1.00
R4846:Fmo3 UTSW 1 162954311 missense possibly damaging 0.94
R4892:Fmo3 UTSW 1 162968731 missense probably benign 0.00
R5102:Fmo3 UTSW 1 162963977 missense probably benign 0.01
R5516:Fmo3 UTSW 1 162954426 nonsense probably null
R6035:Fmo3 UTSW 1 162964036 missense probably damaging 0.97
R6035:Fmo3 UTSW 1 162964036 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGATTCTCAAAGCTTGATAGGTTCC -3'
(R):5'- TGGTGACCATCAAGCCTAATG -3'

Sequencing Primer
(F):5'- AAAGCTTGATAGGTTCCTGTAATTGG -3'
(R):5'- AGTTCACAGAGACGTCCGCTG -3'
Posted On2014-12-04