Incidental Mutation 'R2763:Phkg2'
ID254158
Institutional Source Beutler Lab
Gene Symbol Phkg2
Ensembl Gene ENSMUSG00000030815
Gene Namephosphorylase kinase, gamma 2 (testis)
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.464) question?
Stock #R2763 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location127573340-127583307 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 127579833 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 139 (E139G)
Ref Sequence ENSEMBL: ENSMUSP00000113533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033086] [ENSMUST00000072155] [ENSMUST00000121004] [ENSMUST00000146383] [ENSMUST00000154891] [ENSMUST00000205633]
Predicted Effect probably benign
Transcript: ENSMUST00000033086
AA Change: E139G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000033086
Gene: ENSMUSG00000030815
AA Change: E139G

DomainStartEndE-ValueType
S_TKc 24 291 6.4e-104 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000072155
SMART Domains Protein: ENSMUSP00000072019
Gene: ENSMUSG00000057176

DomainStartEndE-ValueType
Pfam:CLAMP 130 228 3.1e-37 PFAM
low complexity region 243 274 N/A INTRINSIC
coiled coil region 285 319 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121004
AA Change: E139G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113533
Gene: ENSMUSG00000030815
AA Change: E139G

DomainStartEndE-ValueType
S_TKc 24 291 6.4e-104 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129457
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133621
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138158
Predicted Effect probably benign
Transcript: ENSMUST00000146383
SMART Domains Protein: ENSMUSP00000115593
Gene: ENSMUSG00000030815

DomainStartEndE-ValueType
Pfam:Pkinase 24 85 8.6e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149853
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151908
Predicted Effect probably benign
Transcript: ENSMUST00000154891
SMART Domains Protein: ENSMUSP00000116860
Gene: ENSMUSG00000030815

DomainStartEndE-ValueType
Pfam:Pkinase 24 78 4.5e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205633
Predicted Effect probably benign
Transcript: ENSMUST00000205839
Predicted Effect unknown
Transcript: ENSMUST00000206818
AA Change: E48G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206891
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylase kinase is a polymer of 16 subunits, four each of alpha, beta, gamma and delta. The alpha subunit includes the skeletal muscle and hepatic isoforms, encoded by two different genes. The beta subunit is the same in both the muscle and hepatic isoforms, and encoded by one gene. The gamma subunit also includes the skeletal muscle and hepatic isoforms, and the hepatic isoform is encoded by this gene. The delta subunit is a calmodulin and can be encoded by three different genes. The gamma subunits contain the active site of the enzyme, whereas the alpha and beta subunits have regulatory functions controlled by phosphorylation. The delta subunit mediates the dependence of the enzyme on calcium concentration. Mutations in this gene cause glycogen storage disease type 9C, also known as autosomal liver glycogenosis. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene.[provided by RefSeq, Feb 2010]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt T A 15: 83,227,670 D304V probably benign Het
Ablim3 T A 18: 61,813,544 K516* probably null Het
Akap11 A G 14: 78,518,892 F22S probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Ano7 A G 1: 93,399,186 probably null Het
Apol9a T C 15: 77,404,417 E250G probably benign Het
Calcrl T C 2: 84,370,503 R66G probably damaging Het
Camta2 G A 11: 70,682,530 Q187* probably null Het
Cd177 G A 7: 24,758,037 A193V probably benign Het
Cdk5rap2 A G 4: 70,281,271 V872A probably benign Het
Cebpz A G 17: 78,935,929 S99P probably benign Het
Cmtr1 G A 17: 29,680,628 E632K possibly damaging Het
Dysf A T 6: 84,106,932 H782L probably benign Het
Fem1a A G 17: 56,257,537 E210G probably benign Het
Golga3 T C 5: 110,204,895 I884T possibly damaging Het
Gstm6 G A 3: 107,941,042 T173M possibly damaging Het
Pcdhgb8 T A 18: 37,762,262 N128K probably damaging Het
Sdk1 T A 5: 142,084,551 V1157E possibly damaging Het
Sept9 C T 11: 117,326,501 T6I probably benign Het
Shkbp1 T A 7: 27,347,029 M437L probably benign Het
Svep1 A G 4: 58,084,061 C1904R possibly damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Zfp646 T A 7: 127,880,038 C242* probably null Het
Other mutations in Phkg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01953:Phkg2 APN 7 127582340 missense probably damaging 1.00
IGL02259:Phkg2 APN 7 127582286 intron probably benign
IGL02699:Phkg2 APN 7 127582550 missense probably benign
IGL03039:Phkg2 APN 7 127579694 nonsense probably null
R0326:Phkg2 UTSW 7 127573903 missense probably damaging 1.00
R2141:Phkg2 UTSW 7 127582214 critical splice donor site probably null
R2142:Phkg2 UTSW 7 127582214 critical splice donor site probably null
R4614:Phkg2 UTSW 7 127577620 missense probably damaging 1.00
R4615:Phkg2 UTSW 7 127577620 missense probably damaging 1.00
R4616:Phkg2 UTSW 7 127577620 missense probably damaging 1.00
R4666:Phkg2 UTSW 7 127577984 missense possibly damaging 0.93
R4981:Phkg2 UTSW 7 127582379 missense probably damaging 1.00
R4993:Phkg2 UTSW 7 127573941 missense probably damaging 1.00
R5287:Phkg2 UTSW 7 127582757 frame shift probably null
R5416:Phkg2 UTSW 7 127582935 missense possibly damaging 0.46
R7276:Phkg2 UTSW 7 127582386 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TCTCCAGGAGTGCATTTGCTC -3'
(R):5'- TCAAGTTTGGGCCTGCTTC -3'

Sequencing Primer
(F):5'- GGAGTGCATTTGCTCTTCTCC -3'
(R):5'- CCCTCCCTCTGAAGAGATCTGAC -3'
Posted On2014-12-04