Incidental Mutation 'R2763:Zfp646'
ID254160
Institutional Source Beutler Lab
Gene Symbol Zfp646
Ensembl Gene ENSMUSG00000049739
Gene Namezinc finger protein 646
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R2763 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location127876221-127885996 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 127880038 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 242 (C242*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050383] [ENSMUST00000054415] [ENSMUST00000106261] [ENSMUST00000106262] [ENSMUST00000106263] [ENSMUST00000131000] [ENSMUST00000144721]
Predicted Effect probably null
Transcript: ENSMUST00000050383
AA Change: C462*
SMART Domains Protein: ENSMUSP00000052641
Gene: ENSMUSG00000049739
AA Change: C462*

DomainStartEndE-ValueType
ZnF_C2H2 8 31 1.36e-2 SMART
ZnF_C2H2 67 89 5.29e-5 SMART
ZnF_C2H2 231 253 3.21e-4 SMART
ZnF_C2H2 258 280 9.58e-3 SMART
ZnF_C2H2 286 308 2.24e-3 SMART
low complexity region 345 362 N/A INTRINSIC
ZnF_C2H2 366 388 5.42e-2 SMART
ZnF_C2H2 393 415 8.34e-3 SMART
ZnF_C2H2 457 479 5.9e-3 SMART
ZnF_C2H2 484 506 4.87e-4 SMART
ZnF_C2H2 566 588 2.32e-1 SMART
ZnF_C2H2 606 628 6.32e-3 SMART
ZnF_C2H2 633 655 1.53e-1 SMART
low complexity region 737 750 N/A INTRINSIC
low complexity region 786 797 N/A INTRINSIC
ZnF_C2H2 806 828 2.17e-1 SMART
ZnF_C2H2 833 855 3.69e-4 SMART
ZnF_C2H2 866 889 1.16e-1 SMART
low complexity region 890 911 N/A INTRINSIC
ZnF_C2H2 941 961 9.31e1 SMART
ZnF_C2H2 1035 1057 1.95e-3 SMART
ZnF_C2H2 1062 1084 3.39e-3 SMART
low complexity region 1149 1163 N/A INTRINSIC
ZnF_C2H2 1170 1192 1.58e-3 SMART
ZnF_C2H2 1197 1219 5.42e-2 SMART
ZnF_C2H2 1225 1247 3.69e-4 SMART
ZnF_C2H2 1266 1286 5.12e1 SMART
ZnF_C2H2 1293 1315 3.69e-4 SMART
ZnF_C2H2 1333 1355 3.11e-2 SMART
ZnF_C2H2 1550 1572 5.9e-3 SMART
ZnF_C2H2 1640 1662 1.08e-1 SMART
ZnF_C2H2 1667 1689 4.11e-2 SMART
ZnF_C2H2 1695 1717 4.11e-2 SMART
ZnF_C2H2 1724 1746 1.45e-2 SMART
low complexity region 1751 1764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000054415
SMART Domains Protein: ENSMUSP00000056105
Gene: ENSMUSG00000049728

DomainStartEndE-ValueType
ZnF_C2H2 22 44 7.67e-2 SMART
ZnF_C2H2 84 106 9.44e-2 SMART
ZnF_C2H2 112 134 3.63e-3 SMART
ZnF_C2H2 140 162 2.36e-2 SMART
ZnF_C2H2 168 190 1.98e-4 SMART
ZnF_C2H2 196 218 2.91e-2 SMART
ZnF_C2H2 224 246 1.26e-2 SMART
ZnF_C2H2 252 274 5.21e-4 SMART
ZnF_C2H2 280 302 2.57e-3 SMART
ZnF_C2H2 308 330 5.59e-4 SMART
ZnF_C2H2 336 358 1.79e-2 SMART
ZnF_C2H2 364 386 7.9e-4 SMART
ZnF_C2H2 392 414 5.5e-3 SMART
low complexity region 428 470 N/A INTRINSIC
ZnF_C2H2 516 538 3.63e-3 SMART
ZnF_C2H2 544 566 1.3e-4 SMART
ZnF_C2H2 572 594 5.59e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106261
SMART Domains Protein: ENSMUSP00000101868
Gene: ENSMUSG00000049728

DomainStartEndE-ValueType
ZnF_C2H2 22 44 7.67e-2 SMART
ZnF_C2H2 84 106 9.44e-2 SMART
ZnF_C2H2 112 134 3.63e-3 SMART
ZnF_C2H2 140 162 2.36e-2 SMART
ZnF_C2H2 168 190 1.98e-4 SMART
ZnF_C2H2 196 218 2.91e-2 SMART
ZnF_C2H2 224 246 1.26e-2 SMART
ZnF_C2H2 252 274 5.21e-4 SMART
ZnF_C2H2 280 302 2.57e-3 SMART
ZnF_C2H2 308 330 5.59e-4 SMART
ZnF_C2H2 336 358 1.79e-2 SMART
ZnF_C2H2 364 386 7.9e-4 SMART
ZnF_C2H2 392 414 5.5e-3 SMART
low complexity region 428 470 N/A INTRINSIC
ZnF_C2H2 516 538 3.63e-3 SMART
ZnF_C2H2 544 566 1.3e-4 SMART
ZnF_C2H2 572 594 5.59e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106262
SMART Domains Protein: ENSMUSP00000101869
Gene: ENSMUSG00000049728

DomainStartEndE-ValueType
ZnF_C2H2 22 44 7.67e-2 SMART
ZnF_C2H2 84 106 9.44e-2 SMART
ZnF_C2H2 112 134 3.63e-3 SMART
ZnF_C2H2 140 162 2.36e-2 SMART
ZnF_C2H2 168 190 1.98e-4 SMART
ZnF_C2H2 196 218 2.91e-2 SMART
ZnF_C2H2 224 246 1.26e-2 SMART
ZnF_C2H2 252 274 5.21e-4 SMART
ZnF_C2H2 280 302 2.57e-3 SMART
ZnF_C2H2 308 330 5.59e-4 SMART
ZnF_C2H2 336 358 1.79e-2 SMART
ZnF_C2H2 364 386 7.9e-4 SMART
ZnF_C2H2 392 414 5.5e-3 SMART
low complexity region 428 470 N/A INTRINSIC
ZnF_C2H2 516 538 3.63e-3 SMART
ZnF_C2H2 544 566 1.3e-4 SMART
ZnF_C2H2 572 594 5.59e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106263
SMART Domains Protein: ENSMUSP00000101870
Gene: ENSMUSG00000049728

DomainStartEndE-ValueType
ZnF_C2H2 22 44 7.67e-2 SMART
ZnF_C2H2 84 106 9.44e-2 SMART
ZnF_C2H2 112 134 3.63e-3 SMART
ZnF_C2H2 140 162 2.36e-2 SMART
ZnF_C2H2 168 190 1.98e-4 SMART
ZnF_C2H2 196 218 2.91e-2 SMART
ZnF_C2H2 224 246 1.26e-2 SMART
ZnF_C2H2 252 274 5.21e-4 SMART
ZnF_C2H2 280 302 2.57e-3 SMART
ZnF_C2H2 308 330 5.59e-4 SMART
ZnF_C2H2 336 358 1.79e-2 SMART
ZnF_C2H2 364 386 7.9e-4 SMART
ZnF_C2H2 392 414 5.5e-3 SMART
low complexity region 428 470 N/A INTRINSIC
ZnF_C2H2 516 538 3.63e-3 SMART
ZnF_C2H2 544 566 1.3e-4 SMART
ZnF_C2H2 572 594 5.59e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000131000
AA Change: C462*
SMART Domains Protein: ENSMUSP00000115499
Gene: ENSMUSG00000049739
AA Change: C462*

DomainStartEndE-ValueType
ZnF_C2H2 8 31 1.36e-2 SMART
ZnF_C2H2 67 89 5.29e-5 SMART
ZnF_C2H2 231 253 3.21e-4 SMART
ZnF_C2H2 258 280 9.58e-3 SMART
ZnF_C2H2 286 308 2.24e-3 SMART
low complexity region 345 362 N/A INTRINSIC
ZnF_C2H2 366 388 5.42e-2 SMART
ZnF_C2H2 393 415 8.34e-3 SMART
ZnF_C2H2 457 479 5.9e-3 SMART
ZnF_C2H2 484 506 4.87e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144721
SMART Domains Protein: ENSMUSP00000116730
Gene: ENSMUSG00000049728

DomainStartEndE-ValueType
ZnF_C2H2 22 44 7.67e-2 SMART
ZnF_C2H2 84 106 9.44e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150961
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205364
Predicted Effect probably null
Transcript: ENSMUST00000206340
AA Change: C242*
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt T A 15: 83,227,670 D304V probably benign Het
Ablim3 T A 18: 61,813,544 K516* probably null Het
Akap11 A G 14: 78,518,892 F22S probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Ano7 A G 1: 93,399,186 probably null Het
Apol9a T C 15: 77,404,417 E250G probably benign Het
Calcrl T C 2: 84,370,503 R66G probably damaging Het
Camta2 G A 11: 70,682,530 Q187* probably null Het
Cd177 G A 7: 24,758,037 A193V probably benign Het
Cdk5rap2 A G 4: 70,281,271 V872A probably benign Het
Cebpz A G 17: 78,935,929 S99P probably benign Het
Cmtr1 G A 17: 29,680,628 E632K possibly damaging Het
Dysf A T 6: 84,106,932 H782L probably benign Het
Fem1a A G 17: 56,257,537 E210G probably benign Het
Golga3 T C 5: 110,204,895 I884T possibly damaging Het
Gstm6 G A 3: 107,941,042 T173M possibly damaging Het
Pcdhgb8 T A 18: 37,762,262 N128K probably damaging Het
Phkg2 A G 7: 127,579,833 E139G probably benign Het
Sdk1 T A 5: 142,084,551 V1157E possibly damaging Het
Sept9 C T 11: 117,326,501 T6I probably benign Het
Shkbp1 T A 7: 27,347,029 M437L probably benign Het
Svep1 A G 4: 58,084,061 C1904R possibly damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Other mutations in Zfp646
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Zfp646 APN 7 127879130 missense possibly damaging 0.91
IGL01669:Zfp646 APN 7 127878965 missense probably benign
IGL02571:Zfp646 APN 7 127879412 missense probably damaging 1.00
R0009:Zfp646 UTSW 7 127880731 missense probably damaging 0.96
R0084:Zfp646 UTSW 7 127881304 missense possibly damaging 0.86
R0140:Zfp646 UTSW 7 127883506 missense probably benign 0.41
R0394:Zfp646 UTSW 7 127883262 missense possibly damaging 0.85
R0571:Zfp646 UTSW 7 127881966 missense probably damaging 0.96
R0924:Zfp646 UTSW 7 127883810 nonsense probably null
R0930:Zfp646 UTSW 7 127883810 nonsense probably null
R1219:Zfp646 UTSW 7 127883120 missense probably benign
R1221:Zfp646 UTSW 7 127883120 missense probably benign
R1351:Zfp646 UTSW 7 127883511 missense probably benign
R1370:Zfp646 UTSW 7 127879864 missense probably damaging 1.00
R1503:Zfp646 UTSW 7 127880136 missense probably damaging 1.00
R1605:Zfp646 UTSW 7 127880187 unclassified probably null
R1817:Zfp646 UTSW 7 127883120 missense probably benign
R1818:Zfp646 UTSW 7 127883120 missense probably benign
R1819:Zfp646 UTSW 7 127883120 missense probably benign
R1838:Zfp646 UTSW 7 127879739 missense probably damaging 1.00
R1870:Zfp646 UTSW 7 127883849 missense possibly damaging 0.85
R2100:Zfp646 UTSW 7 127882187 missense probably damaging 1.00
R4346:Zfp646 UTSW 7 127879509 missense probably damaging 1.00
R4770:Zfp646 UTSW 7 127883477 missense possibly damaging 0.83
R4824:Zfp646 UTSW 7 127883735 missense probably benign 0.00
R4936:Zfp646 UTSW 7 127881761 missense possibly damaging 0.93
R4937:Zfp646 UTSW 7 127879182 missense probably benign 0.01
R5062:Zfp646 UTSW 7 127880499 missense probably damaging 0.99
R5424:Zfp646 UTSW 7 127882703 missense possibly damaging 0.72
R5610:Zfp646 UTSW 7 127879358 missense probably damaging 1.00
R5729:Zfp646 UTSW 7 127885454 missense probably damaging 0.99
R6112:Zfp646 UTSW 7 127879018 missense possibly damaging 0.71
R6161:Zfp646 UTSW 7 127878725 missense probably damaging 1.00
R6310:Zfp646 UTSW 7 127883907 missense probably benign 0.13
R6331:Zfp646 UTSW 7 127883681 missense probably damaging 0.99
R6436:Zfp646 UTSW 7 127879941 missense probably benign 0.00
R6814:Zfp646 UTSW 7 127883333 missense probably benign 0.17
R6872:Zfp646 UTSW 7 127883333 missense probably benign 0.17
R6903:Zfp646 UTSW 7 127880720 missense possibly damaging 0.91
R7018:Zfp646 UTSW 7 127882322 missense probably benign
R7049:Zfp646 UTSW 7 127880027 missense possibly damaging 0.93
R7121:Zfp646 UTSW 7 127879772 missense possibly damaging 0.95
R7405:Zfp646 UTSW 7 127878796 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGCTATTCAATGCAGCTGC -3'
(R):5'- CGTGGAATGCTGCTTCCATTC -3'

Sequencing Primer
(F):5'- GCTCTGAAAAACCATATTCGTGCTC -3'
(R):5'- TGGGTGAACCTTCAGTCCCTG -3'
Posted On2014-12-04