Incidental Mutation 'R2763:Apol9a'
ID254169
Institutional Source Beutler Lab
Gene Symbol Apol9a
Ensembl Gene ENSMUSG00000057346
Gene Nameapolipoprotein L 9a
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R2763 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location77403789-77411135 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 77404417 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 250 (E250G)
Ref Sequence ENSEMBL: ENSMUSP00000086875 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081776] [ENSMUST00000089452] [ENSMUST00000231161]
Predicted Effect probably benign
Transcript: ENSMUST00000081776
AA Change: E250G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000080468
Gene: ENSMUSG00000057346
AA Change: E250G

DomainStartEndE-ValueType
Pfam:ApoL 1 310 2.7e-118 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089452
AA Change: E250G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000086875
Gene: ENSMUSG00000057346
AA Change: E250G

DomainStartEndE-ValueType
Pfam:ApoL 1 310 1.5e-114 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229175
Predicted Effect probably benign
Transcript: ENSMUST00000231161
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt T A 15: 83,227,670 D304V probably benign Het
Ablim3 T A 18: 61,813,544 K516* probably null Het
Akap11 A G 14: 78,518,892 F22S probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Ano7 A G 1: 93,399,186 probably null Het
Calcrl T C 2: 84,370,503 R66G probably damaging Het
Camta2 G A 11: 70,682,530 Q187* probably null Het
Cd177 G A 7: 24,758,037 A193V probably benign Het
Cdk5rap2 A G 4: 70,281,271 V872A probably benign Het
Cebpz A G 17: 78,935,929 S99P probably benign Het
Cmtr1 G A 17: 29,680,628 E632K possibly damaging Het
Dysf A T 6: 84,106,932 H782L probably benign Het
Fem1a A G 17: 56,257,537 E210G probably benign Het
Golga3 T C 5: 110,204,895 I884T possibly damaging Het
Gstm6 G A 3: 107,941,042 T173M possibly damaging Het
Pcdhgb8 T A 18: 37,762,262 N128K probably damaging Het
Phkg2 A G 7: 127,579,833 E139G probably benign Het
Sdk1 T A 5: 142,084,551 V1157E possibly damaging Het
Sept9 C T 11: 117,326,501 T6I probably benign Het
Shkbp1 T A 7: 27,347,029 M437L probably benign Het
Svep1 A G 4: 58,084,061 C1904R possibly damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Zfp646 T A 7: 127,880,038 C242* probably null Het
Other mutations in Apol9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R3768:Apol9a UTSW 15 77404396 missense probably benign 0.16
R3769:Apol9a UTSW 15 77404396 missense probably benign 0.16
R3770:Apol9a UTSW 15 77404396 missense probably benign 0.16
R4208:Apol9a UTSW 15 77404396 missense probably benign 0.16
R5896:Apol9a UTSW 15 77404505 missense probably benign 0.34
R6093:Apol9a UTSW 15 77404420 missense probably benign 0.27
R6778:Apol9a UTSW 15 77404333 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTTGTAGAATTCCATGAGCCCCTC -3'
(R):5'- CACAAGTGTGGATAGGATTGCC -3'

Sequencing Primer
(F):5'- GAATTCCATGAGCCCCTCTAGCTTC -3'
(R):5'- ATAGGATTGCCAGCAAGGTCCC -3'
Posted On2014-12-04