Incidental Mutation 'R2763:A4galt'
ID254171
Institutional Source Beutler Lab
Gene Symbol A4galt
Ensembl Gene ENSMUSG00000047878
Gene Namealpha 1,4-galactosyltransferase
SynonymsGb3 synthase
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2763 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location83226722-83251774 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 83227670 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 304 (D304V)
Ref Sequence ENSEMBL: ENSMUSP00000129719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049530] [ENSMUST00000164614] [ENSMUST00000229687]
Predicted Effect probably benign
Transcript: ENSMUST00000049530
AA Change: D304V

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000057999
Gene: ENSMUSG00000047878
AA Change: D304V

DomainStartEndE-ValueType
transmembrane domain 31 53 N/A INTRINSIC
Pfam:Gly_transf_sug 97 221 2.6e-30 PFAM
Pfam:Gb3_synth 228 355 2.3e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164614
AA Change: D304V

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000129719
Gene: ENSMUSG00000047878
AA Change: D304V

DomainStartEndE-ValueType
transmembrane domain 31 53 N/A INTRINSIC
Pfam:Gly_transf_sug 97 221 2.6e-30 PFAM
Pfam:Gb3_synth 227 359 3.8e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229454
Predicted Effect probably benign
Transcript: ENSMUST00000229687
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene catalyzes the transfer of galactose to lactosylceramide to form globotriaosylceramide, which has been identified as the P(k) antigen of the P blood group system. The encoded protein, which is a type II membrane protein found in the Golgi, is also required for the synthesis of the bacterial verotoxins receptor. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous null mice display reduced sensitivity to verotoxin but do not display any gross morphological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ablim3 T A 18: 61,813,544 K516* probably null Het
Akap11 A G 14: 78,518,892 F22S probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Ano7 A G 1: 93,399,186 probably null Het
Apol9a T C 15: 77,404,417 E250G probably benign Het
Calcrl T C 2: 84,370,503 R66G probably damaging Het
Camta2 G A 11: 70,682,530 Q187* probably null Het
Cd177 G A 7: 24,758,037 A193V probably benign Het
Cdk5rap2 A G 4: 70,281,271 V872A probably benign Het
Cebpz A G 17: 78,935,929 S99P probably benign Het
Cmtr1 G A 17: 29,680,628 E632K possibly damaging Het
Dysf A T 6: 84,106,932 H782L probably benign Het
Fem1a A G 17: 56,257,537 E210G probably benign Het
Golga3 T C 5: 110,204,895 I884T possibly damaging Het
Gstm6 G A 3: 107,941,042 T173M possibly damaging Het
Pcdhgb8 T A 18: 37,762,262 N128K probably damaging Het
Phkg2 A G 7: 127,579,833 E139G probably benign Het
Sdk1 T A 5: 142,084,551 V1157E possibly damaging Het
Sept9 C T 11: 117,326,501 T6I probably benign Het
Shkbp1 T A 7: 27,347,029 M437L probably benign Het
Svep1 A G 4: 58,084,061 C1904R possibly damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Zfp646 T A 7: 127,880,038 C242* probably null Het
Other mutations in A4galt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01729:A4galt APN 15 83228325 missense probably damaging 0.99
IGL01827:A4galt APN 15 83227934 missense possibly damaging 0.52
IGL02745:A4galt APN 15 83228081 missense probably benign
IGL03201:A4galt APN 15 83228267 missense probably damaging 1.00
R0001:A4galt UTSW 15 83228289 missense probably benign 0.27
R0440:A4galt UTSW 15 83228493 missense probably damaging 0.98
R4331:A4galt UTSW 15 83227679 missense probably damaging 1.00
R4712:A4galt UTSW 15 83227609 missense probably damaging 1.00
R4941:A4galt UTSW 15 83228328 missense probably damaging 1.00
R6003:A4galt UTSW 15 83228111 missense probably benign 0.05
R6247:A4galt UTSW 15 83227819 missense probably damaging 0.99
R6607:A4galt UTSW 15 83228306 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TGAAGGGCTGTCACAAGTACATC -3'
(R):5'- CGCAAGCATGAGTTCTTGGC -3'

Sequencing Primer
(F):5'- GGCTGTCACAAGTACATCTTCATGG -3'
(R):5'- TTCGTGGCCAACTACAATGG -3'
Posted On2014-12-04