Incidental Mutation 'R2763:Cmtr1'
ID254173
Institutional Source Beutler Lab
Gene Symbol Cmtr1
Ensembl Gene ENSMUSG00000024019
Gene Namecap methyltransferase 1
SynonymsFtsjd2, 1300018I05Rik
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.966) question?
Stock #R2763 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location29660595-29705979 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 29680628 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 632 (E632K)
Ref Sequence ENSEMBL: ENSMUSP00000117838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024816] [ENSMUST00000129864] [ENSMUST00000130871]
Predicted Effect probably benign
Transcript: ENSMUST00000024816
AA Change: E192K

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000024816
Gene: ENSMUSG00000024019
AA Change: E192K

DomainStartEndE-ValueType
G_patch 84 130 1.93e-10 SMART
Pfam:FtsJ 231 448 9.5e-42 PFAM
SCOP:d1ckma2 625 718 4e-3 SMART
WW 752 785 2.05e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127695
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128410
Predicted Effect probably benign
Transcript: ENSMUST00000129864
AA Change: E12K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134356
Gene: ENSMUSG00000024019
AA Change: E12K

DomainStartEndE-ValueType
PDB:4N4A|A 1 68 2e-40 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130052
Predicted Effect possibly damaging
Transcript: ENSMUST00000130871
AA Change: E632K

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117838
Gene: ENSMUSG00000098374
AA Change: E632K

DomainStartEndE-ValueType
FHA 37 92 5.55e-8 SMART
low complexity region 116 130 N/A INTRINSIC
low complexity region 299 317 N/A INTRINSIC
RING 406 443 3.64e-7 SMART
G_patch 524 570 1.93e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172516
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt T A 15: 83,227,670 D304V probably benign Het
Ablim3 T A 18: 61,813,544 K516* probably null Het
Akap11 A G 14: 78,518,892 F22S probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Ano7 A G 1: 93,399,186 probably null Het
Apol9a T C 15: 77,404,417 E250G probably benign Het
Calcrl T C 2: 84,370,503 R66G probably damaging Het
Camta2 G A 11: 70,682,530 Q187* probably null Het
Cd177 G A 7: 24,758,037 A193V probably benign Het
Cdk5rap2 A G 4: 70,281,271 V872A probably benign Het
Cebpz A G 17: 78,935,929 S99P probably benign Het
Dysf A T 6: 84,106,932 H782L probably benign Het
Fem1a A G 17: 56,257,537 E210G probably benign Het
Golga3 T C 5: 110,204,895 I884T possibly damaging Het
Gstm6 G A 3: 107,941,042 T173M possibly damaging Het
Pcdhgb8 T A 18: 37,762,262 N128K probably damaging Het
Phkg2 A G 7: 127,579,833 E139G probably benign Het
Sdk1 T A 5: 142,084,551 V1157E possibly damaging Het
Sept9 C T 11: 117,326,501 T6I probably benign Het
Shkbp1 T A 7: 27,347,029 M437L probably benign Het
Svep1 A G 4: 58,084,061 C1904R possibly damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Zfp646 T A 7: 127,880,038 C242* probably null Het
Other mutations in Cmtr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Cmtr1 APN 17 29674262 missense probably damaging 0.99
IGL00980:Cmtr1 APN 17 29691284 missense probably benign 0.00
IGL00987:Cmtr1 APN 17 29697169 missense probably benign 0.01
IGL01413:Cmtr1 APN 17 29697982 missense probably benign 0.00
IGL01481:Cmtr1 APN 17 29698657 missense probably benign 0.02
IGL02281:Cmtr1 APN 17 29691281 missense probably benign 0.00
IGL03079:Cmtr1 APN 17 29663293 missense possibly damaging 0.71
IGL03376:Cmtr1 APN 17 29691411 missense probably benign 0.00
PIT4403001:Cmtr1 UTSW 17 29698073 critical splice donor site probably null
R0256:Cmtr1 UTSW 17 29697124 missense probably damaging 1.00
R0505:Cmtr1 UTSW 17 29676285 missense probably benign 0.17
R1477:Cmtr1 UTSW 17 29697157 missense possibly damaging 0.63
R1623:Cmtr1 UTSW 17 29687047 unclassified probably null
R1852:Cmtr1 UTSW 17 29702255 missense probably benign 0.32
R1867:Cmtr1 UTSW 17 29674174 missense probably benign 0.36
R1918:Cmtr1 UTSW 17 29679009 missense possibly damaging 0.63
R2070:Cmtr1 UTSW 17 29694783 critical splice acceptor site probably null
R2071:Cmtr1 UTSW 17 29694783 critical splice acceptor site probably null
R2161:Cmtr1 UTSW 17 29702173 missense probably benign 0.03
R2518:Cmtr1 UTSW 17 29681980 nonsense probably null
R4077:Cmtr1 UTSW 17 29685975 missense probably damaging 1.00
R4271:Cmtr1 UTSW 17 29697982 missense probably benign 0.00
R4363:Cmtr1 UTSW 17 29674232 missense probably damaging 1.00
R4723:Cmtr1 UTSW 17 29687157 splice site probably null
R4736:Cmtr1 UTSW 17 29700242 missense possibly damaging 0.94
R5056:Cmtr1 UTSW 17 29690328 missense possibly damaging 0.64
R5492:Cmtr1 UTSW 17 29690342 missense probably damaging 1.00
R5704:Cmtr1 UTSW 17 29663243 missense possibly damaging 0.95
R5990:Cmtr1 UTSW 17 29702161 missense probably benign
R6050:Cmtr1 UTSW 17 29682134 missense probably damaging 1.00
R6117:Cmtr1 UTSW 17 29682165 missense probably benign 0.43
R6238:Cmtr1 UTSW 17 29682148 missense probably damaging 1.00
R7199:Cmtr1 UTSW 17 29676200 missense probably benign
R7229:Cmtr1 UTSW 17 29695424 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CATCTCACAGCCATCTGGAG -3'
(R):5'- AAAAGCACTGCCTTGGACAC -3'

Sequencing Primer
(F):5'- GCACAGCCAGAGGGATTTG -3'
(R):5'- TGGACACACCACCACATATACTTC -3'
Posted On2014-12-04