Incidental Mutation 'R2763:Fem1a'
ID254175
Institutional Source Beutler Lab
Gene Symbol Fem1a
Ensembl Gene ENSMUSG00000043683
Gene Namefeminization 1 homolog a (C. elegans)
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R2763 (G1)
Quality Score209
Status Not validated
Chromosome17
Chromosomal Location56256793-56263608 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56257537 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 210 (E210G)
Ref Sequence ENSEMBL: ENSMUSP00000057996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060253]
Predicted Effect probably benign
Transcript: ENSMUST00000060253
AA Change: E210G

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000057996
Gene: ENSMUSG00000043683
AA Change: E210G

DomainStartEndE-ValueType
ANK 2 33 2.43e3 SMART
ANK 40 70 1.7e-3 SMART
ANK 82 111 1.57e-2 SMART
ANK 115 145 1.15e0 SMART
ANK 149 178 8.19e-6 SMART
ANK 182 211 1.93e-2 SMART
ANK 214 243 1.65e-1 SMART
low complexity region 280 289 N/A INTRINSIC
low complexity region 417 428 N/A INTRINSIC
low complexity region 479 490 N/A INTRINSIC
ANK 519 561 7.83e-3 SMART
ANK 565 594 9.78e-4 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous knockout results in an increased susceptibility to DSS-induced colitis and colitis-associated tumorigenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt T A 15: 83,227,670 D304V probably benign Het
Ablim3 T A 18: 61,813,544 K516* probably null Het
Akap11 A G 14: 78,518,892 F22S probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Ano7 A G 1: 93,399,186 probably null Het
Apol9a T C 15: 77,404,417 E250G probably benign Het
Calcrl T C 2: 84,370,503 R66G probably damaging Het
Camta2 G A 11: 70,682,530 Q187* probably null Het
Cd177 G A 7: 24,758,037 A193V probably benign Het
Cdk5rap2 A G 4: 70,281,271 V872A probably benign Het
Cebpz A G 17: 78,935,929 S99P probably benign Het
Cmtr1 G A 17: 29,680,628 E632K possibly damaging Het
Dysf A T 6: 84,106,932 H782L probably benign Het
Golga3 T C 5: 110,204,895 I884T possibly damaging Het
Gstm6 G A 3: 107,941,042 T173M possibly damaging Het
Pcdhgb8 T A 18: 37,762,262 N128K probably damaging Het
Phkg2 A G 7: 127,579,833 E139G probably benign Het
Sdk1 T A 5: 142,084,551 V1157E possibly damaging Het
Sept9 C T 11: 117,326,501 T6I probably benign Het
Shkbp1 T A 7: 27,347,029 M437L probably benign Het
Svep1 A G 4: 58,084,061 C1904R possibly damaging Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Zfp646 T A 7: 127,880,038 C242* probably null Het
Other mutations in Fem1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Fem1a APN 17 56258355 missense possibly damaging 0.82
IGL02947:Fem1a APN 17 56258640 missense probably benign 0.03
R1123:Fem1a UTSW 17 56257791 missense probably damaging 1.00
R1450:Fem1a UTSW 17 56257579 missense probably damaging 1.00
R2165:Fem1a UTSW 17 56257686 missense probably benign
R6273:Fem1a UTSW 17 56257083 missense possibly damaging 0.78
R7384:Fem1a UTSW 17 56257537 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCCTTATGATCTCCTGCTACAAG -3'
(R):5'- AGATCCCTTTTCTTATCCACGTAGG -3'

Sequencing Primer
(F):5'- GATCTCCTGCTACAAGGGCCAC -3'
(R):5'- AGCAGCTCTCATACGGTTCTG -3'
Posted On2014-12-04