Incidental Mutation 'R2764:Htr1d'
ID254190
Institutional Source Beutler Lab
Gene Symbol Htr1d
Ensembl Gene ENSMUSG00000070687
Gene Name5-hydroxytryptamine (serotonin) receptor 1D
SynonymsGpcr14, Htr1db
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2764 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location136423524-136444398 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 136443065 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 202 (A202T)
Ref Sequence ENSEMBL: ENSMUSP00000112402 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088677] [ENSMUST00000117699] [ENSMUST00000121571]
Predicted Effect possibly damaging
Transcript: ENSMUST00000088677
AA Change: A202T

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000086052
Gene: ENSMUSG00000070687
AA Change: A202T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 46 368 1.2e-11 PFAM
Pfam:7tm_1 52 353 1.2e-75 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000117699
AA Change: A202T

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112840
Gene: ENSMUSG00000070687
AA Change: A202T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 46 368 1.2e-11 PFAM
Pfam:7tm_1 52 353 2.7e-86 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000121571
AA Change: A202T

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112402
Gene: ENSMUSG00000070687
AA Change: A202T

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 46 368 1.2e-11 PFAM
Pfam:7tm_1 52 353 2.7e-86 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133818
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam29 A T 8: 55,871,756 D554E probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Bcl2 C T 1: 106,712,436 E149K probably damaging Het
Clcn4 G T 7: 7,296,799 D10E possibly damaging Het
Efr3a T A 15: 65,849,770 F387L possibly damaging Het
Gm9923 C A 10: 72,309,630 H104N probably benign Het
Hmcn2 C T 2: 31,388,298 P1671S probably damaging Het
Ighv9-3 T A 12: 114,140,870 Q58L probably damaging Het
Kat6a A G 8: 22,932,178 K835E probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Mrps30 A G 13: 118,384,588 Y272H probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Sipa1l2 T C 8: 125,492,374 M75V probably damaging Het
Ttn T A 2: 76,791,095 Y13921F probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Vac14 T C 8: 110,710,455 F600S probably damaging Het
Other mutations in Htr1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Htr1d APN 4 136443173 missense probably benign 0.03
IGL01818:Htr1d APN 4 136442886 missense probably benign 0.02
IGL01952:Htr1d APN 4 136443561 missense probably benign 0.08
IGL02696:Htr1d APN 4 136443411 missense probably benign 0.00
R0112:Htr1d UTSW 4 136443000 missense probably benign 0.05
R0147:Htr1d UTSW 4 136443477 missense probably damaging 1.00
R0148:Htr1d UTSW 4 136443477 missense probably damaging 1.00
R2483:Htr1d UTSW 4 136443504 missense probably damaging 0.97
R3622:Htr1d UTSW 4 136443504 missense probably damaging 0.97
R3623:Htr1d UTSW 4 136443504 missense probably damaging 0.97
R3624:Htr1d UTSW 4 136443504 missense probably damaging 0.97
R3894:Htr1d UTSW 4 136443237 missense probably benign 0.00
R4567:Htr1d UTSW 4 136443525 missense probably benign 0.17
R4735:Htr1d UTSW 4 136442886 missense probably benign 0.02
R6190:Htr1d UTSW 4 136442798 missense probably damaging 1.00
R7011:Htr1d UTSW 4 136443006 missense probably benign 0.10
R7123:Htr1d UTSW 4 136442353 start gained probably benign
R7223:Htr1d UTSW 4 136443501 missense probably damaging 1.00
R7328:Htr1d UTSW 4 136443303 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GAGTACAGCAAGCGTCGAAC -3'
(R):5'- GCAAGCTTGATTTTCACCTGG -3'

Sequencing Primer
(F):5'- CCGTCTGGATCATCTCTATT -3'
(R):5'- TTTTCACCTGGTTGAAAAAGAGAGG -3'
Posted On2014-12-04