Mutagenetix > Incidental Mutation

Incidental Mutation 'R2764:Clcn4'

254194

Institutional Source

Beutler Lab

Gene Symbol

Clcn4

Ensembl Gene

ENSMUSG00000000605

Gene Name

chloride channel, voltage-sensitive 4

Synonyms

Clc4-2, Clcn4-2

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2764 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

7285308-7303837 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 7299798 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 10 (D10E)

Ref Sequence

ENSEMBL: ENSMUSP00000148061 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000619] [ENSMUST00000209916] [ENSMUST00000210061] [ENSMUST00000210362] [ENSMUST00000211574] [ENSMUST00000210594]

AlphaFold

Q61418

Predicted Effect

probably benign
Transcript: ENSMUST00000000619
AA Change: D10E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000000619
Gene: ENSMUSG00000000605
AA Change: D10E

Domain	Start	End	E-Value	Type
transmembrane domain	57	79	N/A	INTRINSIC
Pfam:Voltage_CLC	149	552	2.7e-111	PFAM
CBS	596	646	1.07e-1	SMART
CBS	687	734	4.92e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000176903

Predicted Effect

possibly damaging
Transcript: ENSMUST00000209916
AA Change: D10E

PolyPhen 2 Score 0.732 (Sensitivity: 0.86; Specificity: 0.92)

Predicted Effect

probably benign
Transcript: ENSMUST00000210061
AA Change: D10E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210318

Predicted Effect

probably benign
Transcript: ENSMUST00000210362
AA Change: D10E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210444

Predicted Effect

possibly damaging
Transcript: ENSMUST00000211574
AA Change: D10E

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211551

Predicted Effect

probably benign
Transcript: ENSMUST00000210594

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210809

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000210989

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.2%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CLCN family of voltage-dependent chloride channel genes comprises nine members (CLCN1-7, Ka and Kb) which demonstrate quite diverse functional characteristics while sharing significant sequence homology. Chloride channel 4 has an evolutionary conserved CpG island and is conserved in both mouse and hamster. This gene is mapped in close proximity to APXL (Apical protein Xenopus laevis-like) and OA1 (Ocular albinism type I), which are both located on the human X chromosome at band p22.3. The physiological role of chloride channel 4 remains unknown but may contribute to the pathogenesis of neuronal disorders. Alternate splicing results in two transcript variants that encode different proteins. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit no obvious phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 16 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adam29	A	T	8: 56,324,791 (GRCm39)	D554E	probably damaging	Het
Alg11	C	A	8: 22,558,095 (GRCm39)	A469E	probably benign	Het
Bcl2	C	T	1: 106,640,166 (GRCm39)	E149K	probably damaging	Het
Efr3a	T	A	15: 65,721,619 (GRCm39)	F387L	possibly damaging	Het
Gm9923	C	A	10: 72,145,460 (GRCm39)	H104N	probably benign	Het
Hmcn2	C	T	2: 31,278,310 (GRCm39)	P1671S	probably damaging	Het
Htr1d	G	A	4: 136,170,376 (GRCm39)	A202T	possibly damaging	Het
Ighv9-3	T	A	12: 114,104,490 (GRCm39)	Q58L	probably damaging	Het
Kat6a	A	G	8: 23,422,194 (GRCm39)	K835E	probably damaging	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 53,032,934 (GRCm39)	74	probably benign	Het
Mrps30	A	G	13: 118,521,124 (GRCm39)	Y272H	probably benign	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,229,111 (GRCm39)		probably benign	Het
Sipa1l2	T	C	8: 126,219,113 (GRCm39)	M75V	probably damaging	Het
Ttn	T	A	2: 76,621,439 (GRCm39)	Y13921F	probably benign	Het
Ulk1	C	T	5: 110,937,223 (GRCm39)	R691Q	probably benign	Het
Vac14	T	C	8: 111,437,087 (GRCm39)	F600S	probably damaging	Het

Other mutations in Clcn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00978:Clcn4	APN	7	7,290,672 (GRCm39)	missense	probably damaging	0.99
IGL01090:Clcn4	APN	7	7,297,035 (GRCm39)	missense	probably benign	0.01
IGL01650:Clcn4	APN	7	7,287,280 (GRCm39)	splice site	probably benign
IGL02404:Clcn4	APN	7	7,290,857 (GRCm39)	missense	probably benign	0.04
IGL02493:Clcn4	APN	7	7,287,243 (GRCm39)	missense	probably damaging	1.00
IGL02556:Clcn4	APN	7	7,299,065 (GRCm39)	missense	probably benign
IGL02661:Clcn4	APN	7	7,294,730 (GRCm39)	splice site	probably null
IGL02816:Clcn4	APN	7	7,298,087 (GRCm39)	missense	probably damaging	1.00
IGL02882:Clcn4	APN	7	7,293,464 (GRCm39)	missense	probably damaging	1.00
IGL03205:Clcn4	APN	7	7,293,419 (GRCm39)	missense	probably damaging	1.00
IGL03289:Clcn4	APN	7	7,287,257 (GRCm39)	missense	probably damaging	1.00
Delipidated	UTSW	7	7,296,060 (GRCm39)	missense	probably damaging	1.00
R0183:Clcn4	UTSW	7	7,298,090 (GRCm39)	nonsense	probably null
R0379:Clcn4	UTSW	7	7,299,791 (GRCm39)	missense	probably damaging	0.99
R0555:Clcn4	UTSW	7	7,293,503 (GRCm39)	missense	possibly damaging	0.65
R0890:Clcn4	UTSW	7	7,291,964 (GRCm39)	missense	possibly damaging	0.89
R1463:Clcn4	UTSW	7	7,299,763 (GRCm39)	nonsense	probably null
R1549:Clcn4	UTSW	7	7,294,681 (GRCm39)	missense	probably damaging	1.00
R1563:Clcn4	UTSW	7	7,296,981 (GRCm39)	missense	probably damaging	1.00
R1966:Clcn4	UTSW	7	7,287,184 (GRCm39)	makesense	probably null
R2874:Clcn4	UTSW	7	7,293,520 (GRCm39)	missense	probably benign	0.33
R4023:Clcn4	UTSW	7	7,293,427 (GRCm39)	missense	probably damaging	1.00
R4024:Clcn4	UTSW	7	7,293,427 (GRCm39)	missense	probably damaging	1.00
R4152:Clcn4	UTSW	7	7,297,833 (GRCm39)	missense	probably benign	0.02
R4154:Clcn4	UTSW	7	7,297,833 (GRCm39)	missense	probably benign	0.02
R4298:Clcn4	UTSW	7	7,299,737 (GRCm39)	missense	possibly damaging	0.93
R4535:Clcn4	UTSW	7	7,290,813 (GRCm39)	missense	probably benign	0.01
R4574:Clcn4	UTSW	7	7,290,804 (GRCm39)	missense	probably benign	0.23
R4977:Clcn4	UTSW	7	7,294,436 (GRCm39)	missense	probably benign	0.00
R5158:Clcn4	UTSW	7	7,294,618 (GRCm39)	missense	possibly damaging	0.94
R5302:Clcn4	UTSW	7	7,297,050 (GRCm39)	missense	possibly damaging	0.95
R5369:Clcn4	UTSW	7	7,299,032 (GRCm39)	missense	probably benign	0.26
R5624:Clcn4	UTSW	7	7,291,943 (GRCm39)	missense	probably benign	0.35
R5626:Clcn4	UTSW	7	7,292,017 (GRCm39)	missense	probably damaging	1.00
R5723:Clcn4	UTSW	7	7,294,681 (GRCm39)	missense	probably damaging	1.00
R6154:Clcn4	UTSW	7	7,294,481 (GRCm39)	missense	probably benign	0.00
R6259:Clcn4	UTSW	7	7,294,529 (GRCm39)	missense	possibly damaging	0.92
R6396:Clcn4	UTSW	7	7,297,024 (GRCm39)	missense	probably damaging	1.00
R6783:Clcn4	UTSW	7	7,302,181 (GRCm39)	unclassified	probably benign
R7320:Clcn4	UTSW	7	7,294,827 (GRCm39)	missense	probably benign	0.19
R7562:Clcn4	UTSW	7	7,298,081 (GRCm39)	missense	possibly damaging	0.92
R7586:Clcn4	UTSW	7	7,296,958 (GRCm39)	missense	probably benign	0.00
R7752:Clcn4	UTSW	7	7,296,936 (GRCm39)	missense	probably benign
R7860:Clcn4	UTSW	7	7,296,060 (GRCm39)	missense	probably damaging	1.00
R7872:Clcn4	UTSW	7	7,290,780 (GRCm39)	missense	probably benign
R7895:Clcn4	UTSW	7	7,298,167 (GRCm39)	missense	probably benign	0.26
R8069:Clcn4	UTSW	7	7,299,758 (GRCm39)	missense	probably damaging	0.99
R8083:Clcn4	UTSW	7	7,294,427 (GRCm39)	missense	possibly damaging	0.69
R9185:Clcn4	UTSW	7	7,287,197 (GRCm39)	missense	possibly damaging	0.74
R9281:Clcn4	UTSW	7	7,294,813 (GRCm39)	missense	probably benign	0.16
R9333:Clcn4	UTSW	7	7,292,192 (GRCm39)	missense	probably damaging	1.00
R9682:Clcn4	UTSW	7	7,299,797 (GRCm39)	missense	probably benign	0.02
X0019:Clcn4	UTSW	7	7,294,609 (GRCm39)	missense	probably damaging	1.00
Z1177:Clcn4	UTSW	7	7,297,755 (GRCm39)	missense	probably damaging	0.96
Z1177:Clcn4	UTSW	7	7,296,039 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCTCTGTGGAACCGACATGC -3'
(R):5'- ATATCTATGTTGTGGTCCCGCTTAG -3'

Sequencing Primer
(F):5'- GTGGAACCGACATGCGACAC -3'
(R):5'- CCCGCTTAGTTTCTCGGTGGAG -3'

Posted On

2014-12-04