Incidental Mutation 'R0317:Trpa1'
ID25423
Institutional Source Beutler Lab
Gene Symbol Trpa1
Ensembl Gene ENSMUSG00000032769
Gene Nametransient receptor potential cation channel, subfamily A, member 1
SynonymsANKTM1
MMRRC Submission 038527-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R0317 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location14872648-14918862 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14881632 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 948 (T948A)
Ref Sequence ENSEMBL: ENSMUSP00000043594 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041447]
Predicted Effect probably benign
Transcript: ENSMUST00000041447
AA Change: T948A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000043594
Gene: ENSMUSG00000032769
AA Change: T948A

DomainStartEndE-ValueType
ANK 63 94 1.01e2 SMART
ANK 98 127 9.7e-8 SMART
ANK 131 161 1.36e-2 SMART
ANK 165 194 5.45e-2 SMART
ANK 198 226 3.07e2 SMART
ANK 239 268 1.99e-4 SMART
ANK 272 302 1.33e2 SMART
ANK 309 338 4.19e-3 SMART
ANK 342 371 2.34e-1 SMART
ANK 413 442 3.41e-3 SMART
ANK 446 475 5.75e-1 SMART
ANK 482 511 4.1e-6 SMART
ANK 514 543 1.68e-2 SMART
ANK 548 577 4.97e-5 SMART
Blast:ANK 580 609 2e-11 BLAST
Pfam:Ion_trans 736 975 1.8e-11 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The structure of the protein encoded by this gene is highly related to both the protein ankyrin and transmembrane proteins. The specific function of this protein has not yet been determined; however, studies indicate the function may involve a role in signal transduction and growth control. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in altered nociception and neuron responses to isothiocyanate or thiosulfinate compounds like those found in mustard oil and garlic. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,293,459 V1774A probably damaging Het
Adam34 G A 8: 43,652,251 P119L probably benign Het
Ap3b2 T C 7: 81,463,681 probably null Het
Arfip2 G A 7: 105,637,223 T124M probably damaging Het
Arhgef26 T C 3: 62,423,544 S560P probably damaging Het
Bcl11a A T 11: 24,172,697 probably null Het
Cab39 A G 1: 85,849,160 E322G probably damaging Het
Cad C A 5: 31,072,321 P1382Q probably benign Het
Cc2d2a T C 5: 43,706,901 probably null Het
Cela2a A T 4: 141,821,700 probably null Het
Ces1e A C 8: 93,224,039 I38S probably benign Het
Ces1f A T 8: 93,263,391 F364I probably benign Het
Chgb A G 2: 132,793,811 T558A probably benign Het
Cnpy4 C T 5: 138,192,812 Q217* probably null Het
Col4a3bp C T 13: 96,634,121 R487* probably null Het
Crlf1 A G 8: 70,498,599 T43A probably benign Het
Dnah7b T A 1: 46,134,656 M707K probably damaging Het
Ets2 G A 16: 95,712,149 S123N probably damaging Het
Fam196b C A 11: 34,402,826 D289E possibly damaging Het
Fry T C 5: 150,471,468 F304S probably damaging Het
Gadd45gip1 G A 8: 84,834,116 R120H probably benign Het
Gbf1 A G 19: 46,254,020 T96A probably benign Het
Ggn T A 7: 29,171,090 M1K probably null Het
Gm5239 A G 18: 35,536,916 T112A probably benign Het
Kif1bp A T 10: 62,578,082 probably null Het
Lrrc15 A T 16: 30,273,743 H259Q probably benign Het
Lysmd4 A G 7: 67,226,297 Y236C probably damaging Het
Med29 T C 7: 28,386,859 T175A possibly damaging Het
Mfsd12 G T 10: 81,357,799 D68Y probably damaging Het
Myh1 T C 11: 67,217,512 L1308P probably damaging Het
Nphp4 T A 4: 152,551,931 probably null Het
Olfr948 A G 9: 39,319,461 I51T probably benign Het
Pdhx A G 2: 103,028,280 V393A probably benign Het
Pgm5 A G 19: 24,824,399 I155T possibly damaging Het
Pgr A T 9: 8,965,022 I889F probably benign Het
Phactr4 T A 4: 132,386,930 K51I probably damaging Het
Pum2 T A 12: 8,728,754 I468K possibly damaging Het
Rab11a A G 9: 64,725,553 S24P probably damaging Het
Rasef T C 4: 73,748,562 Q160R probably damaging Het
Rbl2 A G 8: 91,087,144 D339G probably benign Het
Recql5 A G 11: 115,894,673 S666P probably benign Het
Rfc1 A T 5: 65,296,052 probably null Het
Scarb1 A G 5: 125,289,692 V59A probably damaging Het
Slc2a4 C T 11: 69,946,356 V85M probably damaging Het
Slc6a12 A G 6: 121,358,625 I291V possibly damaging Het
Slco3a1 A C 7: 74,504,426 Y104D probably damaging Het
Suz12 T A 11: 79,999,078 D13E probably damaging Het
Tlr1 G T 5: 64,925,967 C422* probably null Het
Tmco1 T C 1: 167,325,893 V114A probably damaging Het
Tub A T 7: 109,020,927 N93Y probably damaging Het
Ufsp2 G A 8: 45,992,233 probably null Het
Veph1 T C 3: 66,171,975 D373G probably benign Het
Vmn1r206 A G 13: 22,620,960 S26P possibly damaging Het
Vmn2r1 T C 3: 64,081,819 S60P possibly damaging Het
Wdcp A G 12: 4,851,583 S480G probably benign Het
Wnk4 T C 11: 101,268,804 S612P probably benign Het
Zfp503 T C 14: 21,986,459 K130E probably benign Het
Zkscan16 G A 4: 58,957,602 C628Y possibly damaging Het
Other mutations in Trpa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Trpa1 APN 1 14891333 missense probably damaging 0.97
IGL00937:Trpa1 APN 1 14880277 splice site probably benign
IGL00957:Trpa1 APN 1 14881668 missense probably damaging 0.99
IGL01307:Trpa1 APN 1 14896547 missense probably benign 0.23
IGL01336:Trpa1 APN 1 14886880 splice site probably benign
IGL01408:Trpa1 APN 1 14889413 missense probably benign 0.03
IGL01504:Trpa1 APN 1 14882219 missense possibly damaging 0.79
IGL01543:Trpa1 APN 1 14900076 missense probably damaging 1.00
IGL01609:Trpa1 APN 1 14912383 missense probably damaging 0.99
IGL01895:Trpa1 APN 1 14887643 missense possibly damaging 0.87
IGL02449:Trpa1 APN 1 14898157 missense probably damaging 1.00
IGL02936:Trpa1 APN 1 14875969 splice site probably null
fear-2 UTSW 1 14891303 critical splice donor site probably null
petrified UTSW 1 14884116 missense probably damaging 1.00
R0008:Trpa1 UTSW 1 14903215 missense possibly damaging 0.53
R0008:Trpa1 UTSW 1 14903215 missense possibly damaging 0.53
R0454:Trpa1 UTSW 1 14885748 critical splice donor site probably null
R0828:Trpa1 UTSW 1 14875884 missense probably damaging 1.00
R0944:Trpa1 UTSW 1 14912361 splice site probably null
R0962:Trpa1 UTSW 1 14898163 missense possibly damaging 0.61
R1025:Trpa1 UTSW 1 14904183 missense probably benign 0.01
R1035:Trpa1 UTSW 1 14891303 critical splice donor site probably null
R1134:Trpa1 UTSW 1 14881748 missense possibly damaging 0.95
R1278:Trpa1 UTSW 1 14918723 critical splice donor site probably null
R1497:Trpa1 UTSW 1 14885812 missense probably benign 0.30
R1617:Trpa1 UTSW 1 14873675 missense probably damaging 1.00
R1800:Trpa1 UTSW 1 14874424 missense probably benign 0.04
R1856:Trpa1 UTSW 1 14899388 nonsense probably null
R1886:Trpa1 UTSW 1 14889425 missense probably benign 0.00
R2004:Trpa1 UTSW 1 14905983 missense possibly damaging 0.83
R2152:Trpa1 UTSW 1 14899401 missense probably damaging 1.00
R2172:Trpa1 UTSW 1 14881656 missense probably benign 0.01
R2198:Trpa1 UTSW 1 14910746 missense probably benign
R2221:Trpa1 UTSW 1 14903256 missense probably null 0.12
R2223:Trpa1 UTSW 1 14903256 missense probably null 0.12
R2307:Trpa1 UTSW 1 14912381 missense probably benign 0.00
R2338:Trpa1 UTSW 1 14884245 missense probably damaging 0.97
R2698:Trpa1 UTSW 1 14905998 missense probably damaging 1.00
R2872:Trpa1 UTSW 1 14887620 missense probably damaging 1.00
R2872:Trpa1 UTSW 1 14887620 missense probably damaging 1.00
R2873:Trpa1 UTSW 1 14887620 missense probably damaging 1.00
R2874:Trpa1 UTSW 1 14887620 missense probably damaging 1.00
R3418:Trpa1 UTSW 1 14874381 missense probably benign 0.01
R3419:Trpa1 UTSW 1 14874381 missense probably benign 0.01
R3796:Trpa1 UTSW 1 14893264 missense possibly damaging 0.74
R3799:Trpa1 UTSW 1 14893264 missense possibly damaging 0.74
R4238:Trpa1 UTSW 1 14884116 missense probably damaging 1.00
R4320:Trpa1 UTSW 1 14874452 missense probably benign 0.00
R4591:Trpa1 UTSW 1 14882108 splice site probably null
R4834:Trpa1 UTSW 1 14896523 missense possibly damaging 0.72
R4991:Trpa1 UTSW 1 14910746 missense probably benign 0.00
R4999:Trpa1 UTSW 1 14875861 missense probably benign 0.05
R5038:Trpa1 UTSW 1 14910866 missense probably damaging 1.00
R5055:Trpa1 UTSW 1 14875959 missense probably damaging 1.00
R5158:Trpa1 UTSW 1 14881661 missense probably benign 0.01
R5193:Trpa1 UTSW 1 14875917 missense possibly damaging 0.92
R5558:Trpa1 UTSW 1 14898268 missense probably damaging 1.00
R5578:Trpa1 UTSW 1 14887008 missense probably damaging 1.00
R5680:Trpa1 UTSW 1 14875854 missense probably benign 0.00
R5738:Trpa1 UTSW 1 14875950 missense probably damaging 1.00
R5801:Trpa1 UTSW 1 14898078 missense probably damaging 1.00
R5945:Trpa1 UTSW 1 14898135 missense probably benign 0.03
R6092:Trpa1 UTSW 1 14889486 missense probably damaging 1.00
R6776:Trpa1 UTSW 1 14912377 missense probably benign
R7126:Trpa1 UTSW 1 14890424 missense probably benign 0.00
R7154:Trpa1 UTSW 1 14882233 missense possibly damaging 0.46
R7175:Trpa1 UTSW 1 14893207 missense possibly damaging 0.90
R7258:Trpa1 UTSW 1 14903249 missense probably damaging 1.00
R7358:Trpa1 UTSW 1 14898110 missense probably damaging 1.00
R7412:Trpa1 UTSW 1 14884198 missense probably benign 0.43
X0028:Trpa1 UTSW 1 14890420 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GCAGAGAAATGAGATAGCACACTCCTC -3'
(R):5'- TTTCAGGATGCCTTCAGCACCC -3'

Sequencing Primer
(F):5'- ggatgccattcctctggac -3'
(R):5'- GCCTTCAGCACCCCATTG -3'
Posted On2013-04-16