Incidental Mutation 'R2519:Zfp229'
ID254268
Institutional Source Beutler Lab
Gene Symbol Zfp229
Ensembl Gene ENSMUSG00000061544
Gene Namezinc finger protein 229
Synonyms
MMRRC Submission 040423-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.281) question?
Stock #R2519 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location21730795-21769342 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21745587 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 266 (F266Y)
Ref Sequence ENSEMBL: ENSMUSP00000138107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065871] [ENSMUST00000182603] [ENSMUST00000182827] [ENSMUST00000183192]
Predicted Effect possibly damaging
Transcript: ENSMUST00000065871
AA Change: F266Y

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000065379
Gene: ENSMUSG00000061544
AA Change: F266Y

DomainStartEndE-ValueType
KRAB 13 73 7.74e-30 SMART
ZnF_C2H2 229 249 1.88e2 SMART
ZnF_C2H2 257 279 1.38e-3 SMART
ZnF_C2H2 285 307 3.63e-3 SMART
ZnF_C2H2 312 334 9.44e-2 SMART
ZnF_C2H2 340 362 3.58e-2 SMART
ZnF_C2H2 368 390 2.99e-4 SMART
ZnF_C2H2 395 417 2.36e-2 SMART
ZnF_C2H2 423 445 2.09e-3 SMART
ZnF_C2H2 451 473 1.18e-2 SMART
ZnF_C2H2 479 501 6.78e-3 SMART
ZnF_C2H2 507 529 1.28e-3 SMART
ZnF_C2H2 535 557 7.05e-1 SMART
ZnF_C2H2 562 584 8.02e-5 SMART
ZnF_C2H2 590 612 9.58e-3 SMART
ZnF_C2H2 618 640 7.78e-3 SMART
ZnF_C2H2 646 668 3.83e-2 SMART
ZnF_C2H2 674 696 1.72e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000182603
AA Change: F266Y

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000138107
Gene: ENSMUSG00000061544
AA Change: F266Y

DomainStartEndE-ValueType
KRAB 13 73 7.74e-30 SMART
Pfam:zf-C2H2_6 205 219 3.9e-1 PFAM
ZnF_C2H2 229 249 1.88e2 SMART
ZnF_C2H2 257 279 1.38e-3 SMART
ZnF_C2H2 285 307 3.63e-3 SMART
ZnF_C2H2 312 334 9.44e-2 SMART
ZnF_C2H2 340 362 3.58e-2 SMART
ZnF_C2H2 368 390 2.99e-4 SMART
ZnF_C2H2 395 417 2.36e-2 SMART
ZnF_C2H2 423 445 2.09e-3 SMART
ZnF_C2H2 451 473 1.18e-2 SMART
ZnF_C2H2 479 501 6.78e-3 SMART
ZnF_C2H2 507 529 1.28e-3 SMART
ZnF_C2H2 535 557 7.05e-1 SMART
ZnF_C2H2 562 584 8.02e-5 SMART
ZnF_C2H2 590 612 9.58e-3 SMART
ZnF_C2H2 618 640 7.78e-3 SMART
ZnF_C2H2 646 668 3.83e-2 SMART
ZnF_C2H2 674 696 1.72e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182827
SMART Domains Protein: ENSMUSP00000138478
Gene: ENSMUSG00000061544

DomainStartEndE-ValueType
KRAB 13 73 7.74e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183192
SMART Domains Protein: ENSMUSP00000138265
Gene: ENSMUSG00000061544

DomainStartEndE-ValueType
KRAB 13 73 7.74e-30 SMART
Meta Mutation Damage Score 0.202 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (72/73)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933408J17Rik G A 10: 93,589,588 probably benign Het
Actn1 A T 12: 80,192,389 H247Q probably damaging Het
Adgre1 T C 17: 57,410,956 C323R probably damaging Het
Adgrf2 T A 17: 42,710,407 I509F probably damaging Het
Aknad1 A T 3: 108,756,468 T331S probably damaging Het
Aldh1a3 T C 7: 66,422,299 D39G probably benign Het
Alms1 C A 6: 85,667,963 probably benign Het
Ankhd1 T G 18: 36,578,543 probably null Het
Arfgef2 T C 2: 166,881,244 S1535P probably benign Het
BC027072 C T 17: 71,751,647 S345N probably damaging Het
Bicc1 T C 10: 70,930,644 E916G probably damaging Het
Birc2 A T 9: 7,821,179 D381E possibly damaging Het
Btbd11 T A 10: 85,651,611 V981D probably damaging Het
Carnmt1 A G 19: 18,693,711 I316V probably benign Het
Chd6 T A 2: 161,029,876 Y213F possibly damaging Het
Coq7 A T 7: 118,510,148 W226R unknown Het
Cyp2d9 G A 15: 82,454,518 probably null Het
Ddx42 T A 11: 106,245,329 N635K probably damaging Het
Dmtf1 T C 5: 9,129,323 T292A possibly damaging Het
Dnajb8 T C 6: 88,222,875 V131A probably benign Het
Dock6 T C 9: 21,816,333 E1367G possibly damaging Het
Dvl1 T A 4: 155,855,543 Y377* probably null Het
Eif4g3 T A 4: 138,097,318 F278Y probably benign Het
Fancg A T 4: 43,008,787 L150H probably damaging Het
Fastkd5 T C 2: 130,616,194 T159A possibly damaging Het
Fkrp G T 7: 16,810,952 Y328* probably null Het
Fmo3 A T 1: 162,958,305 V372D probably damaging Het
Gm10639 T G 9: 78,304,439 L161R probably damaging Het
Gm12184 A G 11: 48,826,123 I76T probably damaging Het
Gm5065 A T 7: 5,359,834 I155F probably damaging Het
Gtf2h4 C A 17: 35,670,909 G143W probably damaging Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hmcn1 A T 1: 150,773,820 Y638* probably null Het
Ighv11-2 T A 12: 114,048,292 Q101L probably damaging Het
Lipf G T 19: 33,965,525 V78L probably damaging Het
Magi3 T C 3: 104,015,765 E1212G probably benign Het
Mfap5 T C 6: 122,525,989 S75P probably damaging Het
Mn1 C A 5: 111,418,552 H129Q possibly damaging Het
Morc3 A G 16: 93,862,539 probably null Het
Mrc2 G A 11: 105,348,431 probably null Het
Myo5c A G 9: 75,250,436 I224V probably damaging Het
Nupl1 T C 14: 60,223,359 T486A probably benign Het
Olfr1026 A G 2: 85,923,607 Y113C probably damaging Het
Olfr910 T A 9: 38,538,985 V30D probably damaging Het
Parp14 A T 16: 35,858,203 L465Q possibly damaging Het
Plcd3 A T 11: 103,080,400 I110N possibly damaging Het
Prx A G 7: 27,518,243 E862G probably benign Het
Rad50 G A 11: 53,707,185 probably benign Het
Rbm15 A G 3: 107,330,833 S750P probably benign Het
Reln C A 5: 22,344,369 A14S unknown Het
Rph3a T C 5: 120,954,422 Y372C probably damaging Het
Serpine2 T A 1: 79,799,539 H187L possibly damaging Het
Slc11a2 T C 15: 100,401,323 D122G probably damaging Het
Slc25a32 A T 15: 39,096,055 V289E probably damaging Het
Slc25a46 A T 18: 31,602,761 S142T probably benign Het
Srm A G 4: 148,591,504 probably null Het
Srsf5 A G 12: 80,949,096 D123G probably damaging Het
Stab1 A T 14: 31,154,872 C832S probably damaging Het
Stab2 A C 10: 86,934,840 probably benign Het
Suds3 T C 5: 117,094,953 N282S probably damaging Het
Taar9 A T 10: 24,109,254 V94E probably damaging Het
Taf2 C A 15: 55,052,247 A428S probably benign Het
Tbk1 G T 10: 121,557,259 T462K probably benign Het
Tcaf2 T G 6: 42,629,431 I530L possibly damaging Het
Tigd4 A G 3: 84,593,914 Y46C probably damaging Het
Topors G T 4: 40,261,714 Y523* probably null Het
Tpte T C 8: 22,333,160 probably benign Het
Trpv5 T A 6: 41,674,350 Q254L probably damaging Het
Trpv6 G A 6: 41,624,616 Q457* probably null Het
Ush2a A T 1: 188,267,107 M205L probably benign Het
Vmn1r90 A T 7: 14,561,718 Y152N probably damaging Het
Vmn2r124 T A 17: 18,074,018 V789D probably damaging Het
Vmn2r99 T C 17: 19,378,708 I218T probably damaging Het
Vstm2b T C 7: 40,902,875 V248A probably benign Het
Wnk2 T C 13: 49,071,029 K1019E probably damaging Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp616 T A 11: 74,084,268 C454* probably null Het
Other mutations in Zfp229
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00733:Zfp229 APN 17 21739502 missense possibly damaging 0.52
R0268:Zfp229 UTSW 17 21745841 missense probably benign
R0344:Zfp229 UTSW 17 21745841 missense probably benign
R0608:Zfp229 UTSW 17 21746634 missense probably damaging 1.00
R1672:Zfp229 UTSW 17 21745847 missense probably damaging 1.00
R2215:Zfp229 UTSW 17 21746277 missense possibly damaging 0.90
R2937:Zfp229 UTSW 17 21745503 missense probably damaging 1.00
R2965:Zfp229 UTSW 17 21746029 missense probably damaging 1.00
R3108:Zfp229 UTSW 17 21746816 missense probably damaging 1.00
R3768:Zfp229 UTSW 17 21745863 missense probably damaging 1.00
R3778:Zfp229 UTSW 17 21745202 missense probably benign 0.44
R3850:Zfp229 UTSW 17 21745862 missense probably damaging 1.00
R4273:Zfp229 UTSW 17 21746821 missense probably benign 0.02
R4731:Zfp229 UTSW 17 21745286 missense possibly damaging 0.73
R4732:Zfp229 UTSW 17 21745286 missense possibly damaging 0.73
R4733:Zfp229 UTSW 17 21745286 missense possibly damaging 0.73
R4818:Zfp229 UTSW 17 21743904 missense probably benign 0.33
R4929:Zfp229 UTSW 17 21746373 missense probably damaging 1.00
R5512:Zfp229 UTSW 17 21745036 splice site probably null
R7124:Zfp229 UTSW 17 21742616 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAGTCAGAGTCATGGAATCTACATAGG -3'
(R):5'- TGAGCACCGGGTAAAGAACTTG -3'

Sequencing Primer
(F):5'- GAATGCGATAAAACTTTTGGCTC -3'
(R):5'- CCGGGTAAAGAACTTGTCACATTTCC -3'
Posted On2014-12-04