Incidental Mutation 'R0317:Pdhx'
ID25428
Institutional Source Beutler Lab
Gene Symbol Pdhx
Ensembl Gene ENSMUSG00000010914
Gene Namepyruvate dehydrogenase complex, component X
SynonymsPdx1
MMRRC Submission 038527-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0317 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location103021075-103073513 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103028280 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 393 (V393A)
Ref Sequence ENSEMBL: ENSMUSP00000011058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011058] [ENSMUST00000132449]
Predicted Effect probably benign
Transcript: ENSMUST00000011058
AA Change: V393A

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000011058
Gene: ENSMUSG00000010914
AA Change: V393A

DomainStartEndE-ValueType
low complexity region 13 28 N/A INTRINSIC
Pfam:Biotin_lipoyl 57 131 1.3e-21 PFAM
low complexity region 148 172 N/A INTRINSIC
Pfam:E3_binding 182 217 5e-9 PFAM
low complexity region 233 249 N/A INTRINSIC
Pfam:2-oxoacid_dh 272 501 8.4e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132449
SMART Domains Protein: ENSMUSP00000119172
Gene: ENSMUSG00000010914

DomainStartEndE-ValueType
Pfam:Biotin_lipoyl 5 66 1.3e-14 PFAM
low complexity region 83 107 N/A INTRINSIC
Pfam:E3_binding 115 153 6.1e-14 PFAM
low complexity region 168 184 N/A INTRINSIC
Meta Mutation Damage Score 0.068 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The pyruvate dehydrogenase (PDH) complex is located in the mitochondrial matrix and catalyzes the conversion of pyruvate to acetyl coenzyme A. The PDH complex thereby links glycolysis to Krebs cycle. The PDH complex contains three catalytic subunits, E1, E2, and E3, two regulatory subunits, E1 kinase and E1 phosphatase, and a non-catalytic subunit, E3 binding protein (E3BP). This gene encodes the E3 binding protein subunit; also known as component X of the pyruvate dehydrogenase complex. This protein tethers E3 dimers to the E2 core of the PDH complex. Defects in this gene are a cause of pyruvate dehydrogenase deficiency which results in neurological dysfunction and lactic acidosis in infancy and early childhood. This protein is also a minor antigen for antimitochondrial antibodies. These autoantibodies are present in nearly 95% of patients with the autoimmune liver disease primary biliary cirrhosis (PBC). In PBC, activated T lymphocytes attack and destroy epithelial cells in the bile duct where this protein is abnormally distributed and overexpressed. PBC eventually leads to cirrhosis and liver failure. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,293,459 V1774A probably damaging Het
Adam34 G A 8: 43,652,251 P119L probably benign Het
Ap3b2 T C 7: 81,463,681 probably null Het
Arfip2 G A 7: 105,637,223 T124M probably damaging Het
Arhgef26 T C 3: 62,423,544 S560P probably damaging Het
Bcl11a A T 11: 24,172,697 probably null Het
Cab39 A G 1: 85,849,160 E322G probably damaging Het
Cad C A 5: 31,072,321 P1382Q probably benign Het
Cc2d2a T C 5: 43,706,901 probably null Het
Cela2a A T 4: 141,821,700 probably null Het
Ces1e A C 8: 93,224,039 I38S probably benign Het
Ces1f A T 8: 93,263,391 F364I probably benign Het
Chgb A G 2: 132,793,811 T558A probably benign Het
Cnpy4 C T 5: 138,192,812 Q217* probably null Het
Col4a3bp C T 13: 96,634,121 R487* probably null Het
Crlf1 A G 8: 70,498,599 T43A probably benign Het
Dnah7b T A 1: 46,134,656 M707K probably damaging Het
Ets2 G A 16: 95,712,149 S123N probably damaging Het
Fam196b C A 11: 34,402,826 D289E possibly damaging Het
Fry T C 5: 150,471,468 F304S probably damaging Het
Gadd45gip1 G A 8: 84,834,116 R120H probably benign Het
Gbf1 A G 19: 46,254,020 T96A probably benign Het
Ggn T A 7: 29,171,090 M1K probably null Het
Gm5239 A G 18: 35,536,916 T112A probably benign Het
Kif1bp A T 10: 62,578,082 probably null Het
Lrrc15 A T 16: 30,273,743 H259Q probably benign Het
Lysmd4 A G 7: 67,226,297 Y236C probably damaging Het
Med29 T C 7: 28,386,859 T175A possibly damaging Het
Mfsd12 G T 10: 81,357,799 D68Y probably damaging Het
Myh1 T C 11: 67,217,512 L1308P probably damaging Het
Nphp4 T A 4: 152,551,931 probably null Het
Olfr948 A G 9: 39,319,461 I51T probably benign Het
Pgm5 A G 19: 24,824,399 I155T possibly damaging Het
Pgr A T 9: 8,965,022 I889F probably benign Het
Phactr4 T A 4: 132,386,930 K51I probably damaging Het
Pum2 T A 12: 8,728,754 I468K possibly damaging Het
Rab11a A G 9: 64,725,553 S24P probably damaging Het
Rasef T C 4: 73,748,562 Q160R probably damaging Het
Rbl2 A G 8: 91,087,144 D339G probably benign Het
Recql5 A G 11: 115,894,673 S666P probably benign Het
Rfc1 A T 5: 65,296,052 probably null Het
Scarb1 A G 5: 125,289,692 V59A probably damaging Het
Slc2a4 C T 11: 69,946,356 V85M probably damaging Het
Slc6a12 A G 6: 121,358,625 I291V possibly damaging Het
Slco3a1 A C 7: 74,504,426 Y104D probably damaging Het
Suz12 T A 11: 79,999,078 D13E probably damaging Het
Tlr1 G T 5: 64,925,967 C422* probably null Het
Tmco1 T C 1: 167,325,893 V114A probably damaging Het
Trpa1 T C 1: 14,881,632 T948A probably benign Het
Tub A T 7: 109,020,927 N93Y probably damaging Het
Ufsp2 G A 8: 45,992,233 probably null Het
Veph1 T C 3: 66,171,975 D373G probably benign Het
Vmn1r206 A G 13: 22,620,960 S26P possibly damaging Het
Vmn2r1 T C 3: 64,081,819 S60P possibly damaging Het
Wdcp A G 12: 4,851,583 S480G probably benign Het
Wnk4 T C 11: 101,268,804 S612P probably benign Het
Zfp503 T C 14: 21,986,459 K130E probably benign Het
Zkscan16 G A 4: 58,957,602 C628Y possibly damaging Het
Other mutations in Pdhx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02147:Pdhx APN 2 103030341 unclassified probably benign
IGL02450:Pdhx APN 2 103042249 missense probably benign 0.00
R0152:Pdhx UTSW 2 103028280 missense probably benign 0.04
R2351:Pdhx UTSW 2 103024217 nonsense probably null
R3937:Pdhx UTSW 2 103022219 missense probably damaging 1.00
R3950:Pdhx UTSW 2 103035241 missense probably damaging 0.99
R4546:Pdhx UTSW 2 103073397 missense probably null 0.99
R4677:Pdhx UTSW 2 103073466 unclassified probably null
R4744:Pdhx UTSW 2 103042296 missense probably benign 0.01
R4996:Pdhx UTSW 2 103030312 missense probably damaging 1.00
R5000:Pdhx UTSW 2 103041040 splice site probably null
R5076:Pdhx UTSW 2 103041077 missense probably damaging 0.99
R5682:Pdhx UTSW 2 103035340 missense probably benign 0.00
R6246:Pdhx UTSW 2 103046792 missense probably damaging 1.00
R6850:Pdhx UTSW 2 103041100 missense probably damaging 1.00
R7141:Pdhx UTSW 2 103073314 missense probably benign 0.21
R7219:Pdhx UTSW 2 103028415 missense probably benign 0.01
R7460:Pdhx UTSW 2 103046779 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCAGAACATGAATGAAGCTGACC -3'
(R):5'- AGGCTGCTTCCTTCATAGCATGTC -3'

Sequencing Primer
(F):5'- GAAGCTGACCTCTAATTTACATGC -3'
(R):5'- ATGTCTTTTCCTGCTTACAGCAAATG -3'
Posted On2013-04-16