Incidental Mutation 'R2520:Zfhx4'
ID254302
Institutional Source Beutler Lab
Gene Symbol Zfhx4
Ensembl Gene ENSMUSG00000025255
Gene Namezinc finger homeodomain 4
SynonymsZfh4, C130041O22Rik, Zfh-4
MMRRC Submission 040424-MU
Accession Numbers

Genbank: NM_030708; MGI: 2137668

Is this an essential gene? Possibly essential (E-score: 0.508) question?
Stock #R2520 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location5218526-5415857 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 5403358 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 2859 (P2859S)
Ref Sequence ENSEMBL: ENSMUSP00000135289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026284] [ENSMUST00000175866] [ENSMUST00000176383]
Predicted Effect probably benign
Transcript: ENSMUST00000026284
AA Change: P2859S

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000026284
Gene: ENSMUSG00000025255
AA Change: P2859S

DomainStartEndE-ValueType
ZnF_C2H2 80 99 1.78e2 SMART
low complexity region 110 122 N/A INTRINSIC
ZnF_C2H2 277 300 1.55e1 SMART
low complexity region 421 438 N/A INTRINSIC
low complexity region 470 475 N/A INTRINSIC
low complexity region 590 610 N/A INTRINSIC
ZnF_C2H2 611 634 2.45e0 SMART
ZnF_C2H2 642 665 6.78e-3 SMART
ZnF_U1 694 728 1.8e-1 SMART
ZnF_C2H2 697 721 4.87e-4 SMART
low complexity region 754 763 N/A INTRINSIC
ZnF_C2H2 765 789 6.67e-2 SMART
ZnF_C2H2 876 897 2.44e2 SMART
ZnF_U1 912 946 2.88e0 SMART
ZnF_C2H2 915 939 1.23e0 SMART
ZnF_C2H2 971 993 7.05e-1 SMART
ZnF_U1 1016 1050 3.73e0 SMART
ZnF_C2H2 1019 1043 4.98e-1 SMART
ZnF_C2H2 1188 1211 1.1e-2 SMART
ZnF_C2H2 1217 1240 4.94e0 SMART
ZnF_C2H2 1368 1390 7.67e-2 SMART
ZnF_C2H2 1396 1419 1.33e-1 SMART
ZnF_U1 1509 1543 7.4e-1 SMART
ZnF_C2H2 1512 1536 8.22e-2 SMART
ZnF_U1 1561 1595 3.73e0 SMART
ZnF_C2H2 1564 1588 1.16e-1 SMART
low complexity region 1664 1692 N/A INTRINSIC
low complexity region 1701 1713 N/A INTRINSIC
low complexity region 1762 1808 N/A INTRINSIC
ZnF_C2H2 1916 1939 3.07e-1 SMART
low complexity region 1964 1990 N/A INTRINSIC
low complexity region 2008 2032 N/A INTRINSIC
low complexity region 2055 2072 N/A INTRINSIC
HOX 2100 2162 4.23e-16 SMART
HOX 2197 2259 5.62e-21 SMART
ZnF_C2H2 2283 2303 1.13e1 SMART
low complexity region 2364 2376 N/A INTRINSIC
low complexity region 2408 2425 N/A INTRINSIC
low complexity region 2449 2460 N/A INTRINSIC
ZnF_C2H2 2461 2483 2.17e-1 SMART
HOX 2573 2635 3.18e-20 SMART
ZnF_C2H2 2643 2666 6.67e-2 SMART
low complexity region 2874 2886 N/A INTRINSIC
HOX 2896 2958 4.54e-16 SMART
ZnF_U1 2971 3005 6.59e-1 SMART
ZnF_C2H2 2974 2998 1.36e1 SMART
low complexity region 3066 3078 N/A INTRINSIC
low complexity region 3106 3119 N/A INTRINSIC
low complexity region 3163 3186 N/A INTRINSIC
coiled coil region 3279 3308 N/A INTRINSIC
ZnF_C2H2 3368 3388 1.12e2 SMART
ZnF_U1 3409 3443 6.16e-2 SMART
ZnF_C2H2 3412 3436 6.57e0 SMART
low complexity region 3461 3479 N/A INTRINSIC
low complexity region 3505 3527 N/A INTRINSIC
low complexity region 3536 3547 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000175866
AA Change: P2884S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000135827
Gene: ENSMUSG00000025255
AA Change: P2884S

DomainStartEndE-ValueType
ZnF_C2H2 80 99 1.78e2 SMART
low complexity region 110 122 N/A INTRINSIC
ZnF_C2H2 277 300 1.55e1 SMART
low complexity region 421 438 N/A INTRINSIC
low complexity region 470 475 N/A INTRINSIC
low complexity region 590 610 N/A INTRINSIC
ZnF_C2H2 611 634 2.45e0 SMART
ZnF_C2H2 642 665 6.78e-3 SMART
ZnF_U1 694 728 1.8e-1 SMART
ZnF_C2H2 697 721 4.87e-4 SMART
low complexity region 754 763 N/A INTRINSIC
ZnF_C2H2 765 789 6.67e-2 SMART
ZnF_C2H2 902 923 2.44e2 SMART
ZnF_U1 938 972 2.88e0 SMART
ZnF_C2H2 941 965 1.23e0 SMART
ZnF_C2H2 997 1019 7.05e-1 SMART
ZnF_U1 1042 1076 3.73e0 SMART
ZnF_C2H2 1045 1069 4.98e-1 SMART
ZnF_C2H2 1213 1236 1.1e-2 SMART
ZnF_C2H2 1242 1265 4.94e0 SMART
ZnF_C2H2 1393 1415 7.67e-2 SMART
ZnF_C2H2 1421 1444 1.33e-1 SMART
ZnF_U1 1534 1568 7.4e-1 SMART
ZnF_C2H2 1537 1561 8.22e-2 SMART
ZnF_U1 1586 1620 3.73e0 SMART
ZnF_C2H2 1589 1613 1.16e-1 SMART
low complexity region 1689 1717 N/A INTRINSIC
low complexity region 1726 1738 N/A INTRINSIC
low complexity region 1787 1833 N/A INTRINSIC
ZnF_C2H2 1941 1964 3.07e-1 SMART
low complexity region 1989 2015 N/A INTRINSIC
low complexity region 2033 2057 N/A INTRINSIC
low complexity region 2080 2097 N/A INTRINSIC
HOX 2125 2187 4.23e-16 SMART
HOX 2222 2284 5.62e-21 SMART
ZnF_C2H2 2308 2328 1.13e1 SMART
low complexity region 2389 2401 N/A INTRINSIC
low complexity region 2433 2450 N/A INTRINSIC
low complexity region 2474 2485 N/A INTRINSIC
ZnF_C2H2 2486 2508 2.17e-1 SMART
HOX 2598 2660 3.18e-20 SMART
ZnF_C2H2 2668 2691 6.67e-2 SMART
low complexity region 2899 2911 N/A INTRINSIC
HOX 2921 2983 4.54e-16 SMART
ZnF_U1 2996 3030 6.59e-1 SMART
ZnF_C2H2 2999 3023 1.36e1 SMART
low complexity region 3091 3103 N/A INTRINSIC
low complexity region 3131 3144 N/A INTRINSIC
low complexity region 3188 3211 N/A INTRINSIC
coiled coil region 3304 3333 N/A INTRINSIC
ZnF_C2H2 3393 3413 1.12e2 SMART
ZnF_U1 3434 3468 6.16e-2 SMART
ZnF_C2H2 3437 3461 6.57e0 SMART
low complexity region 3486 3504 N/A INTRINSIC
low complexity region 3530 3552 N/A INTRINSIC
low complexity region 3561 3572 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176383
AA Change: P2859S

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135289
Gene: ENSMUSG00000025255
AA Change: P2859S

DomainStartEndE-ValueType
ZnF_C2H2 80 99 1.78e2 SMART
low complexity region 110 122 N/A INTRINSIC
ZnF_C2H2 277 300 1.55e1 SMART
low complexity region 421 438 N/A INTRINSIC
low complexity region 470 475 N/A INTRINSIC
low complexity region 590 610 N/A INTRINSIC
ZnF_C2H2 611 634 2.45e0 SMART
ZnF_C2H2 642 665 6.78e-3 SMART
ZnF_U1 694 728 1.8e-1 SMART
ZnF_C2H2 697 721 4.87e-4 SMART
low complexity region 754 763 N/A INTRINSIC
ZnF_C2H2 765 789 6.67e-2 SMART
ZnF_C2H2 876 897 2.44e2 SMART
ZnF_U1 912 946 2.88e0 SMART
ZnF_C2H2 915 939 1.23e0 SMART
ZnF_C2H2 971 993 7.05e-1 SMART
ZnF_U1 1016 1050 3.73e0 SMART
ZnF_C2H2 1019 1043 4.98e-1 SMART
ZnF_C2H2 1188 1211 1.1e-2 SMART
ZnF_C2H2 1217 1240 4.94e0 SMART
ZnF_C2H2 1368 1390 7.67e-2 SMART
ZnF_C2H2 1396 1419 1.33e-1 SMART
ZnF_U1 1509 1543 7.4e-1 SMART
ZnF_C2H2 1512 1536 8.22e-2 SMART
ZnF_U1 1561 1595 3.73e0 SMART
ZnF_C2H2 1564 1588 1.16e-1 SMART
low complexity region 1664 1692 N/A INTRINSIC
low complexity region 1701 1713 N/A INTRINSIC
low complexity region 1762 1808 N/A INTRINSIC
ZnF_C2H2 1916 1939 3.07e-1 SMART
low complexity region 1964 1990 N/A INTRINSIC
low complexity region 2008 2032 N/A INTRINSIC
low complexity region 2055 2072 N/A INTRINSIC
HOX 2100 2162 4.23e-16 SMART
HOX 2197 2259 5.62e-21 SMART
ZnF_C2H2 2283 2303 1.13e1 SMART
low complexity region 2364 2376 N/A INTRINSIC
low complexity region 2408 2425 N/A INTRINSIC
low complexity region 2449 2460 N/A INTRINSIC
ZnF_C2H2 2461 2483 2.17e-1 SMART
HOX 2573 2635 3.18e-20 SMART
ZnF_C2H2 2643 2666 6.67e-2 SMART
low complexity region 2874 2886 N/A INTRINSIC
HOX 2896 2958 4.54e-16 SMART
ZnF_U1 2971 3005 6.59e-1 SMART
ZnF_C2H2 2974 2998 1.36e1 SMART
low complexity region 3066 3078 N/A INTRINSIC
low complexity region 3106 3119 N/A INTRINSIC
low complexity region 3163 3186 N/A INTRINSIC
coiled coil region 3279 3308 N/A INTRINSIC
ZnF_C2H2 3368 3388 1.12e2 SMART
ZnF_U1 3409 3443 6.16e-2 SMART
ZnF_C2H2 3412 3436 6.57e0 SMART
low complexity region 3461 3479 N/A INTRINSIC
low complexity region 3505 3527 N/A INTRINSIC
low complexity region 3536 3547 N/A INTRINSIC
Meta Mutation Damage Score 0.068 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700109H08Rik A T 5: 3,575,773 N70I probably damaging Het
4930503B20Rik G A 3: 146,650,506 R216W probably damaging Het
Abcb9 C T 5: 124,080,028 probably null Het
Arhgdia A T 11: 120,580,026 V72E probably damaging Het
Arsb A T 13: 93,940,699 K525* probably null Het
Bckdha A C 7: 25,641,699 I79S probably benign Het
Carm1 G A 9: 21,583,597 probably null Het
Cers5 G A 15: 99,736,381 T362I probably damaging Het
Clec4b2 T A 6: 123,200,983 F86I probably damaging Het
Crispld1 G A 1: 17,750,776 D347N probably damaging Het
Csf3r A T 4: 126,035,352 T352S probably benign Het
Daam2 G A 17: 49,480,757 Q443* probably null Het
Dcbld1 A G 10: 52,319,545 D283G probably damaging Het
Dpp9 T C 17: 56,206,868 E82G probably damaging Het
Dync1li1 A G 9: 114,689,006 D42G probably null Het
Eml6 T C 11: 29,791,993 H1130R probably damaging Het
Enox1 A T 14: 77,582,399 Y198F probably damaging Het
Epop A G 11: 97,628,728 L185P probably benign Het
Frem1 A T 4: 82,950,290 C1485S probably damaging Het
Gbf1 T A 19: 46,265,367 S571T probably benign Het
Gm5965 A T 16: 88,778,526 I196F probably null Het
Gm8237 T A 14: 5,863,642 I8L possibly damaging Het
Gria2 A C 3: 80,706,962 N590K probably damaging Het
Hectd2 T A 19: 36,612,233 probably null Het
Hmcn1 T A 1: 150,743,647 T1239S possibly damaging Het
Hps3 A T 3: 20,029,030 D167E probably damaging Het
Htr1a A G 13: 105,445,373 S374G probably benign Het
Il16 C T 7: 83,651,994 G307S probably benign Het
Ipmk T C 10: 71,381,217 F198S probably damaging Het
Lyz2 T A 10: 117,278,653 I124F probably damaging Het
Maea T C 5: 33,358,510 V47A probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrgpra1 A T 7: 47,335,272 C220S possibly damaging Het
Myo5c A T 9: 75,297,649 K1595* probably null Het
Naga G T 15: 82,330,094 D405E probably benign Het
Nanog T A 6: 122,713,459 N249K probably benign Het
Nhlh1 G T 1: 172,054,003 R99S probably damaging Het
Ntrk2 T A 13: 59,054,276 probably null Het
Nudt2 A G 4: 41,480,354 E79G probably benign Het
Olfr1313 A T 2: 112,071,668 M305K probably benign Het
Olfr1368 A T 13: 21,142,576 C160* probably null Het
Olfr666 T A 7: 104,892,873 I252F probably benign Het
Pitpnm2 T C 5: 124,129,401 D592G probably damaging Het
Prps1l3 T C 12: 57,238,583 V53A probably damaging Het
Psmd2 T G 16: 20,663,076 V853G probably damaging Het
Pycard A G 7: 127,993,505 I50T possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf168 T A 16: 32,278,403 S99T probably benign Het
Rph3al A G 11: 75,906,547 S108P possibly damaging Het
Sdk1 G A 5: 142,085,771 A979T probably benign Het
Sec16a G A 2: 26,441,356 Q216* probably null Het
Slc35f3 T A 8: 126,394,573 V391E possibly damaging Het
Slf1 T A 13: 77,051,265 I666F probably damaging Het
Slfn14 A G 11: 83,276,187 V834A probably damaging Het
Tab2 G A 10: 7,907,481 P679L probably damaging Het
Tbc1d10b A G 7: 127,200,283 probably null Het
Tmeff1 T A 4: 48,604,679 C91S probably damaging Het
Tmem108 G T 9: 103,489,282 N503K possibly damaging Het
Trbv29 A G 6: 41,271,607 T24A probably damaging Het
Trim34b A G 7: 104,331,239 E178G probably damaging Het
Trmt1l T A 1: 151,453,945 H546Q probably benign Het
Ttc39d A G 17: 80,216,370 I153V probably benign Het
Ttll13 T C 7: 80,250,216 V101A probably damaging Het
Ubash3b A T 9: 41,014,947 H501Q probably damaging Het
Upf3a T A 8: 13,796,443 probably null Het
Usp48 A G 4: 137,625,251 S94G probably benign Het
Wdr86 T C 5: 24,712,575 *381W probably null Het
Wdr90 G A 17: 25,855,352 P680S probably damaging Het
Zbtb22 G A 17: 33,916,982 V34M probably damaging Het
Zbtb8a A G 4: 129,359,896 probably null Het
Zfp512b A G 2: 181,589,502 V295A probably damaging Het
Zfp608 A T 18: 54,988,506 V3E possibly damaging Het
Zfp748 G T 13: 67,546,662 D32E possibly damaging Het
Other mutations in Zfhx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Zfhx4 APN 3 5242341 missense probably damaging 1.00
IGL00915:Zfhx4 APN 3 5245523 missense probably damaging 0.99
IGL01145:Zfhx4 APN 3 5245347 missense probably damaging 1.00
IGL01302:Zfhx4 APN 3 5243568 missense probably damaging 1.00
IGL01314:Zfhx4 APN 3 5413094 missense probably damaging 0.98
IGL01321:Zfhx4 APN 3 5242328 missense probably benign 0.01
IGL01328:Zfhx4 APN 3 5244284 missense probably damaging 1.00
IGL01333:Zfhx4 APN 3 5399327 missense probably damaging 1.00
IGL01351:Zfhx4 APN 3 5401136 missense probably damaging 1.00
IGL01524:Zfhx4 APN 3 5243976 missense probably damaging 1.00
IGL01549:Zfhx4 APN 3 5399462 missense probably damaging 1.00
IGL01715:Zfhx4 APN 3 5242045 missense probably benign 0.00
IGL01736:Zfhx4 APN 3 5244092 missense possibly damaging 0.85
IGL01904:Zfhx4 APN 3 5412709 missense probably damaging 1.00
IGL02298:Zfhx4 APN 3 5244304 splice site probably null
IGL02342:Zfhx4 APN 3 5402374 missense probably benign 0.14
IGL02465:Zfhx4 APN 3 5399603 missense possibly damaging 0.48
IGL02481:Zfhx4 APN 3 5411843 missense probably damaging 0.99
IGL02511:Zfhx4 APN 3 5399183 missense probably damaging 1.00
IGL02571:Zfhx4 APN 3 5329523 missense probably damaging 1.00
IGL02685:Zfhx4 APN 3 5412153 missense probably damaging 1.00
IGL02721:Zfhx4 APN 3 5243307 missense possibly damaging 0.76
IGL02806:Zfhx4 APN 3 5390408 missense probably benign 0.00
IGL03140:Zfhx4 APN 3 5242525 missense probably damaging 1.00
IGL03185:Zfhx4 APN 3 5403914 missense probably benign 0.05
IGL03209:Zfhx4 APN 3 5401171 missense probably damaging 1.00
IGL03292:Zfhx4 APN 3 5411780 nonsense probably null
IGL03302:Zfhx4 APN 3 5403713 missense possibly damaging 0.88
IGL03303:Zfhx4 APN 3 5403350 missense probably damaging 1.00
IGL03341:Zfhx4 APN 3 5411850 missense probably damaging 0.98
3-1:Zfhx4 UTSW 3 5403385 missense probably benign 0.14
B5639:Zfhx4 UTSW 3 5403175 missense probably damaging 0.99
IGL02796:Zfhx4 UTSW 3 5399539 missense probably damaging 1.00
IGL03047:Zfhx4 UTSW 3 5243733 missense probably damaging 0.99
P0025:Zfhx4 UTSW 3 5399588 missense probably benign 0.04
R0090:Zfhx4 UTSW 3 5243625 missense probably damaging 1.00
R0107:Zfhx4 UTSW 3 5398982 missense probably damaging 1.00
R0401:Zfhx4 UTSW 3 5401161 missense possibly damaging 0.87
R0465:Zfhx4 UTSW 3 5245656 splice site probably benign
R0506:Zfhx4 UTSW 3 5402735 missense probably damaging 1.00
R0507:Zfhx4 UTSW 3 5400988 nonsense probably null
R0550:Zfhx4 UTSW 3 5400494 missense probably damaging 0.99
R0576:Zfhx4 UTSW 3 5402101 missense probably damaging 1.00
R0590:Zfhx4 UTSW 3 5402633 missense probably damaging 1.00
R0697:Zfhx4 UTSW 3 5401733 missense probably damaging 0.99
R0727:Zfhx4 UTSW 3 5401073 missense probably damaging 0.98
R0762:Zfhx4 UTSW 3 5403820 missense probably damaging 1.00
R0815:Zfhx4 UTSW 3 5245315 missense possibly damaging 0.87
R0863:Zfhx4 UTSW 3 5245315 missense possibly damaging 0.87
R0866:Zfhx4 UTSW 3 5412212 missense possibly damaging 0.58
R1109:Zfhx4 UTSW 3 5399870 missense possibly damaging 0.59
R1177:Zfhx4 UTSW 3 5400831 small deletion probably benign
R1338:Zfhx4 UTSW 3 5396961 missense possibly damaging 0.86
R1388:Zfhx4 UTSW 3 5401387 missense probably damaging 1.00
R1434:Zfhx4 UTSW 3 5241859 missense probably benign 0.00
R1470:Zfhx4 UTSW 3 5413146 makesense probably null
R1470:Zfhx4 UTSW 3 5413146 makesense probably null
R1552:Zfhx4 UTSW 3 5403110 missense probably damaging 1.00
R1589:Zfhx4 UTSW 3 5241729 missense probably damaging 1.00
R1633:Zfhx4 UTSW 3 5400413 missense probably damaging 1.00
R1656:Zfhx4 UTSW 3 5413016 missense probably damaging 1.00
R1717:Zfhx4 UTSW 3 5403104 missense probably benign 0.20
R1739:Zfhx4 UTSW 3 5401730 missense probably damaging 1.00
R1760:Zfhx4 UTSW 3 5382616 missense probably benign
R1842:Zfhx4 UTSW 3 5401498 missense probably damaging 1.00
R1867:Zfhx4 UTSW 3 5412714 missense probably damaging 1.00
R1868:Zfhx4 UTSW 3 5412714 missense probably damaging 1.00
R2064:Zfhx4 UTSW 3 5398927 missense probably damaging 1.00
R2083:Zfhx4 UTSW 3 5403163 missense possibly damaging 0.58
R2154:Zfhx4 UTSW 3 5401741 missense possibly damaging 0.86
R2165:Zfhx4 UTSW 3 5403358 missense probably benign 0.32
R2181:Zfhx4 UTSW 3 5403332 missense probably damaging 1.00
R2201:Zfhx4 UTSW 3 5242289 missense probably damaging 1.00
R2209:Zfhx4 UTSW 3 5396918 missense probably damaging 1.00
R2303:Zfhx4 UTSW 3 5397060 missense probably damaging 0.99
R2327:Zfhx4 UTSW 3 5403358 missense probably benign 0.32
R2420:Zfhx4 UTSW 3 5390405 missense probably benign 0.00
R2422:Zfhx4 UTSW 3 5390405 missense probably benign 0.00
R2516:Zfhx4 UTSW 3 5403358 missense probably benign 0.32
R2518:Zfhx4 UTSW 3 5403358 missense probably benign 0.32
R2519:Zfhx4 UTSW 3 5403358 missense probably benign 0.32
R2566:Zfhx4 UTSW 3 5245143 missense probably damaging 0.98
R2922:Zfhx4 UTSW 3 5403664 missense probably damaging 1.00
R3000:Zfhx4 UTSW 3 5403654 missense probably damaging 1.00
R3103:Zfhx4 UTSW 3 5399326 missense probably damaging 1.00
R3409:Zfhx4 UTSW 3 5403358 missense probably benign 0.32
R3414:Zfhx4 UTSW 3 5403823 missense probably damaging 1.00
R3746:Zfhx4 UTSW 3 5243165 missense possibly damaging 0.82
R3747:Zfhx4 UTSW 3 5243165 missense possibly damaging 0.82
R3748:Zfhx4 UTSW 3 5243165 missense possibly damaging 0.82
R3749:Zfhx4 UTSW 3 5243165 missense possibly damaging 0.82
R3750:Zfhx4 UTSW 3 5243165 missense possibly damaging 0.82
R3763:Zfhx4 UTSW 3 5403344 missense probably damaging 1.00
R3826:Zfhx4 UTSW 3 5401209 missense probably damaging 1.00
R3827:Zfhx4 UTSW 3 5401209 missense probably damaging 1.00
R3830:Zfhx4 UTSW 3 5401209 missense probably damaging 1.00
R3877:Zfhx4 UTSW 3 5400785 missense probably benign
R3919:Zfhx4 UTSW 3 5399115 missense possibly damaging 0.48
R3922:Zfhx4 UTSW 3 5400647 missense probably damaging 1.00
R3927:Zfhx4 UTSW 3 5403358 missense probably benign 0.32
R3965:Zfhx4 UTSW 3 5403847 missense probably damaging 1.00
R4004:Zfhx4 UTSW 3 5403358 missense probably benign 0.32
R4049:Zfhx4 UTSW 3 5398859 missense probably damaging 1.00
R4073:Zfhx4 UTSW 3 5399324 missense probably damaging 1.00
R4134:Zfhx4 UTSW 3 5243627 missense probably damaging 1.00
R4401:Zfhx4 UTSW 3 5403345 nonsense probably null
R4439:Zfhx4 UTSW 3 5214815 unclassified probably benign
R4497:Zfhx4 UTSW 3 5399620 missense possibly damaging 0.88
R4518:Zfhx4 UTSW 3 5412518 missense probably damaging 1.00
R4569:Zfhx4 UTSW 3 5401834 missense probably benign 0.00
R4612:Zfhx4 UTSW 3 5397063 missense probably damaging 1.00
R4616:Zfhx4 UTSW 3 5413067 missense possibly damaging 0.66
R4626:Zfhx4 UTSW 3 5402639 missense probably damaging 1.00
R4628:Zfhx4 UTSW 3 5403476 missense probably damaging 1.00
R4637:Zfhx4 UTSW 3 5403404 missense probably damaging 1.00
R4647:Zfhx4 UTSW 3 5399281 missense probably damaging 0.99
R4708:Zfhx4 UTSW 3 5245503 unclassified probably null
R4729:Zfhx4 UTSW 3 5399497 missense probably damaging 1.00
R4732:Zfhx4 UTSW 3 5214807 unclassified probably benign
R4757:Zfhx4 UTSW 3 5400062 missense possibly damaging 0.85
R4765:Zfhx4 UTSW 3 5400152 missense probably benign
R4819:Zfhx4 UTSW 3 5403914 missense probably benign 0.05
R4937:Zfhx4 UTSW 3 5242011 missense probably damaging 1.00
R4980:Zfhx4 UTSW 3 5398979 missense possibly damaging 0.47
R5124:Zfhx4 UTSW 3 5242047 missense probably damaging 1.00
R5214:Zfhx4 UTSW 3 5403641 missense probably damaging 1.00
R5361:Zfhx4 UTSW 3 5399207 missense probably damaging 0.99
R5375:Zfhx4 UTSW 3 5412425 missense probably damaging 0.99
R5485:Zfhx4 UTSW 3 5243007 missense probably damaging 1.00
R5588:Zfhx4 UTSW 3 5403138 missense probably damaging 1.00
R5609:Zfhx4 UTSW 3 5403619 missense probably damaging 1.00
R5726:Zfhx4 UTSW 3 5403321 missense probably benign 0.02
R5758:Zfhx4 UTSW 3 5402620 missense probably damaging 1.00
R5865:Zfhx4 UTSW 3 5402659 missense probably damaging 1.00
R5938:Zfhx4 UTSW 3 5402138 missense probably damaging 0.99
R5952:Zfhx4 UTSW 3 5396970 missense probably damaging 0.99
R6043:Zfhx4 UTSW 3 5403427 missense probably benign 0.00
R6045:Zfhx4 UTSW 3 5396959 missense probably damaging 1.00
R6125:Zfhx4 UTSW 3 5398811 missense possibly damaging 0.68
R6354:Zfhx4 UTSW 3 5401951 missense probably benign
R6374:Zfhx4 UTSW 3 5244035 missense probably damaging 1.00
R6378:Zfhx4 UTSW 3 5243350 missense probably benign 0.07
R6380:Zfhx4 UTSW 3 5413110 missense probably damaging 0.99
R6413:Zfhx4 UTSW 3 5243145 missense probably damaging 1.00
R6449:Zfhx4 UTSW 3 5242428 missense probably damaging 1.00
R6539:Zfhx4 UTSW 3 5244108 missense probably damaging 0.99
R6714:Zfhx4 UTSW 3 5241837 missense probably damaging 1.00
R6933:Zfhx4 UTSW 3 5412987 missense probably damaging 0.99
R6982:Zfhx4 UTSW 3 5403830 missense probably damaging 1.00
R7104:Zfhx4 UTSW 3 5402489 missense not run
R7127:Zfhx4 UTSW 3 5413044 missense not run
R7138:Zfhx4 UTSW 3 5412047 missense not run
X0025:Zfhx4 UTSW 3 5411836 missense probably damaging 0.99
X0026:Zfhx4 UTSW 3 5412338 missense probably benign 0.00
X0028:Zfhx4 UTSW 3 5402414 missense probably benign 0.13
X0028:Zfhx4 UTSW 3 5403267 missense probably damaging 1.00
X0054:Zfhx4 UTSW 3 5399710 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCTTTGTCCCCTAAAGAAACC -3'
(R):5'- GCAGACCAATCTCATTGCCC -3'

Sequencing Primer
(F):5'- GAAACCAAAACTCTTGACTCTTTGC -3'
(R):5'- CGATAGTCACTGAAGCAAGCCTTG -3'
Posted On2014-12-04