Incidental Mutation 'R0317:Arhgef26'
ID25431
Institutional Source Beutler Lab
Gene Symbol Arhgef26
Ensembl Gene ENSMUSG00000036885
Gene NameRho guanine nucleotide exchange factor (GEF) 26
Synonyms4631416L12Rik, 8430436L14Rik
MMRRC Submission 038527-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.155) question?
Stock #R0317 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location62338344-62462221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62423544 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 560 (S560P)
Ref Sequence ENSEMBL: ENSMUSP00000078281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079300]
Predicted Effect probably damaging
Transcript: ENSMUST00000079300
AA Change: S560P

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000078281
Gene: ENSMUSG00000036885
AA Change: S560P

DomainStartEndE-ValueType
low complexity region 133 144 N/A INTRINSIC
low complexity region 392 403 N/A INTRINSIC
RhoGEF 441 620 1e-45 SMART
PH 654 782 4.04e-9 SMART
SH3 790 847 3.82e-13 SMART
Predicted Effect unknown
Transcript: ENSMUST00000161057
AA Change: S26P
SMART Domains Protein: ENSMUSP00000124392
Gene: ENSMUSG00000036885
AA Change: S26P

DomainStartEndE-ValueType
Pfam:RhoGEF 2 87 2.3e-19 PFAM
PH 121 249 4.04e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192138
Meta Mutation Damage Score 0.094 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho-guanine nucleotide exchange factor (Rho-GEF) family. These proteins regulate Rho GTPases by catalyzing the exchange of GDP for GTP. The encoded protein specifically activates RhoG and plays a role in the promotion of macropinocytosis. Underexpression of the encoded protein may be a predictive marker of chemoresistant disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit defective activation of RhoG and reduced membrane protrusion after ICAM-1 clustering. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,293,459 V1774A probably damaging Het
Adam34 G A 8: 43,652,251 P119L probably benign Het
Ap3b2 T C 7: 81,463,681 probably null Het
Arfip2 G A 7: 105,637,223 T124M probably damaging Het
Bcl11a A T 11: 24,172,697 probably null Het
Cab39 A G 1: 85,849,160 E322G probably damaging Het
Cad C A 5: 31,072,321 P1382Q probably benign Het
Cc2d2a T C 5: 43,706,901 probably null Het
Cela2a A T 4: 141,821,700 probably null Het
Ces1e A C 8: 93,224,039 I38S probably benign Het
Ces1f A T 8: 93,263,391 F364I probably benign Het
Chgb A G 2: 132,793,811 T558A probably benign Het
Cnpy4 C T 5: 138,192,812 Q217* probably null Het
Col4a3bp C T 13: 96,634,121 R487* probably null Het
Crlf1 A G 8: 70,498,599 T43A probably benign Het
Dnah7b T A 1: 46,134,656 M707K probably damaging Het
Ets2 G A 16: 95,712,149 S123N probably damaging Het
Fam196b C A 11: 34,402,826 D289E possibly damaging Het
Fry T C 5: 150,471,468 F304S probably damaging Het
Gadd45gip1 G A 8: 84,834,116 R120H probably benign Het
Gbf1 A G 19: 46,254,020 T96A probably benign Het
Ggn T A 7: 29,171,090 M1K probably null Het
Gm5239 A G 18: 35,536,916 T112A probably benign Het
Kif1bp A T 10: 62,578,082 probably null Het
Lrrc15 A T 16: 30,273,743 H259Q probably benign Het
Lysmd4 A G 7: 67,226,297 Y236C probably damaging Het
Med29 T C 7: 28,386,859 T175A possibly damaging Het
Mfsd12 G T 10: 81,357,799 D68Y probably damaging Het
Myh1 T C 11: 67,217,512 L1308P probably damaging Het
Nphp4 T A 4: 152,551,931 probably null Het
Olfr948 A G 9: 39,319,461 I51T probably benign Het
Pdhx A G 2: 103,028,280 V393A probably benign Het
Pgm5 A G 19: 24,824,399 I155T possibly damaging Het
Pgr A T 9: 8,965,022 I889F probably benign Het
Phactr4 T A 4: 132,386,930 K51I probably damaging Het
Pum2 T A 12: 8,728,754 I468K possibly damaging Het
Rab11a A G 9: 64,725,553 S24P probably damaging Het
Rasef T C 4: 73,748,562 Q160R probably damaging Het
Rbl2 A G 8: 91,087,144 D339G probably benign Het
Recql5 A G 11: 115,894,673 S666P probably benign Het
Rfc1 A T 5: 65,296,052 probably null Het
Scarb1 A G 5: 125,289,692 V59A probably damaging Het
Slc2a4 C T 11: 69,946,356 V85M probably damaging Het
Slc6a12 A G 6: 121,358,625 I291V possibly damaging Het
Slco3a1 A C 7: 74,504,426 Y104D probably damaging Het
Suz12 T A 11: 79,999,078 D13E probably damaging Het
Tlr1 G T 5: 64,925,967 C422* probably null Het
Tmco1 T C 1: 167,325,893 V114A probably damaging Het
Trpa1 T C 1: 14,881,632 T948A probably benign Het
Tub A T 7: 109,020,927 N93Y probably damaging Het
Ufsp2 G A 8: 45,992,233 probably null Het
Veph1 T C 3: 66,171,975 D373G probably benign Het
Vmn1r206 A G 13: 22,620,960 S26P possibly damaging Het
Vmn2r1 T C 3: 64,081,819 S60P possibly damaging Het
Wdcp A G 12: 4,851,583 S480G probably benign Het
Wnk4 T C 11: 101,268,804 S612P probably benign Het
Zfp503 T C 14: 21,986,459 K130E probably benign Het
Zkscan16 G A 4: 58,957,602 C628Y possibly damaging Het
Other mutations in Arhgef26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Arhgef26 APN 3 62340383 missense probably benign
IGL01060:Arhgef26 APN 3 62340121 missense probably benign 0.44
IGL01942:Arhgef26 APN 3 62340094 missense probably benign 0.03
IGL02085:Arhgef26 APN 3 62459724 intron probably benign
IGL02172:Arhgef26 APN 3 62459676 missense probably benign 0.03
IGL03017:Arhgef26 APN 3 62448281 missense possibly damaging 0.46
IGL03101:Arhgef26 APN 3 62419661 missense possibly damaging 0.95
IGL03296:Arhgef26 APN 3 62423505 missense probably damaging 1.00
IGL03401:Arhgef26 APN 3 62423532 missense possibly damaging 0.95
R0138:Arhgef26 UTSW 3 62448259 missense probably benign 0.06
R0140:Arhgef26 UTSW 3 62448245 missense probably benign 0.02
R0152:Arhgef26 UTSW 3 62423544 missense probably damaging 0.99
R0157:Arhgef26 UTSW 3 62380971 missense probably damaging 1.00
R0308:Arhgef26 UTSW 3 62340399 missense probably benign 0.01
R0529:Arhgef26 UTSW 3 62339725 missense probably benign
R0825:Arhgef26 UTSW 3 62426593 missense probably damaging 0.97
R1331:Arhgef26 UTSW 3 62340028 missense probably benign 0.00
R1333:Arhgef26 UTSW 3 62340323 missense probably benign 0.04
R1351:Arhgef26 UTSW 3 62380841 missense probably damaging 1.00
R1740:Arhgef26 UTSW 3 62423583 missense probably damaging 1.00
R2121:Arhgef26 UTSW 3 62340283 missense probably damaging 0.96
R2404:Arhgef26 UTSW 3 62428915 missense possibly damaging 0.90
R2437:Arhgef26 UTSW 3 62432581 missense probably damaging 0.96
R2939:Arhgef26 UTSW 3 62380910 missense possibly damaging 0.72
R3084:Arhgef26 UTSW 3 62377616 missense probably benign 0.19
R3712:Arhgef26 UTSW 3 62423629 missense probably damaging 1.00
R4005:Arhgef26 UTSW 3 62340395 missense probably benign
R4225:Arhgef26 UTSW 3 62380922 missense probably benign 0.00
R4635:Arhgef26 UTSW 3 62340440 missense probably damaging 1.00
R4961:Arhgef26 UTSW 3 62459625 missense probably damaging 1.00
R4989:Arhgef26 UTSW 3 62340385 missense possibly damaging 0.94
R5249:Arhgef26 UTSW 3 62340560 missense probably damaging 1.00
R5284:Arhgef26 UTSW 3 62419631 missense probably damaging 0.99
R5661:Arhgef26 UTSW 3 62377654 splice site probably benign
R5970:Arhgef26 UTSW 3 62340047 missense probably benign
R6022:Arhgef26 UTSW 3 62428939 missense probably damaging 1.00
R6193:Arhgef26 UTSW 3 62339792 missense possibly damaging 0.49
R6247:Arhgef26 UTSW 3 62380960 missense probably damaging 1.00
R6434:Arhgef26 UTSW 3 62428914 missense probably damaging 0.99
R6827:Arhgef26 UTSW 3 62423498 splice site probably null
R7111:Arhgef26 UTSW 3 62345268 missense possibly damaging 0.90
R7128:Arhgef26 UTSW 3 62419550 missense possibly damaging 0.94
R7360:Arhgef26 UTSW 3 62448205 missense possibly damaging 0.63
R7456:Arhgef26 UTSW 3 62340055 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCATTGGTAATGTGGAACCGACCTG -3'
(R):5'- CCATTTCCAAGTGAAACTGAGCCCC -3'

Sequencing Primer
(F):5'- AACCGACCTGTGTATTTGGTAATG -3'
(R):5'- cagatttagtgactcagacaaaaatg -3'
Posted On2013-04-16