Incidental Mutation 'R2520:Csf3r'
ID254322
Institutional Source Beutler Lab
Gene Symbol Csf3r
Ensembl Gene ENSMUSG00000028859
Gene Namecolony stimulating factor 3 receptor (granulocyte)
SynonymsG-CSFR, Cd114, Csfgr
MMRRC Submission 040424-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.317) question?
Stock #R2520 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location126024550-126044440 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 126035352 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 352 (T352S)
Ref Sequence ENSEMBL: ENSMUSP00000101768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030673] [ENSMUST00000106162]
Predicted Effect probably benign
Transcript: ENSMUST00000030673
AA Change: T352S

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000030673
Gene: ENSMUSG00000028859
AA Change: T352S

DomainStartEndE-ValueType
Pfam:Lep_receptor_Ig 24 111 2.3e-30 PFAM
FN3 124 213 5.38e1 SMART
SCOP:d1cd9b2 226 332 3e-15 SMART
Blast:FN3 334 420 3e-30 BLAST
FN3 432 518 2.41e0 SMART
FN3 530 612 1.92e-3 SMART
transmembrane domain 627 649 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106162
AA Change: T352S

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000101768
Gene: ENSMUSG00000028859
AA Change: T352S

DomainStartEndE-ValueType
Pfam:Lep_receptor_Ig 22 112 6.8e-30 PFAM
FN3 124 213 5.38e1 SMART
SCOP:d1cd9b2 226 332 3e-15 SMART
Blast:FN3 334 420 3e-30 BLAST
FN3 432 518 2.41e0 SMART
FN3 530 612 1.92e-3 SMART
transmembrane domain 627 649 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153968
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the receptor for colony stimulating factor 3, a cytokine that controls the production, differentiation, and function of granulocytes. The encoded protein, which is a member of the family of cytokine receptors, may also function in some cell surface adhesion or recognition processes. Alternatively spliced transcript variants have been described. Mutations in this gene are a cause of Kostmann syndrome, also known as severe congenital neutropenia. [provided by RefSeq, Aug 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced numbers of peripheral neutrophils, with fewer hematopoietic progenitors in bone marrow and impaired expansion and terminal differentiation of progenitors into granulocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700109H08Rik A T 5: 3,575,773 N70I probably damaging Het
4930503B20Rik G A 3: 146,650,506 R216W probably damaging Het
Abcb9 C T 5: 124,080,028 probably null Het
Arhgdia A T 11: 120,580,026 V72E probably damaging Het
Arsb A T 13: 93,940,699 K525* probably null Het
Bckdha A C 7: 25,641,699 I79S probably benign Het
Carm1 G A 9: 21,583,597 probably null Het
Cers5 G A 15: 99,736,381 T362I probably damaging Het
Clec4b2 T A 6: 123,200,983 F86I probably damaging Het
Crispld1 G A 1: 17,750,776 D347N probably damaging Het
Daam2 G A 17: 49,480,757 Q443* probably null Het
Dcbld1 A G 10: 52,319,545 D283G probably damaging Het
Dpp9 T C 17: 56,206,868 E82G probably damaging Het
Dync1li1 A G 9: 114,689,006 D42G probably null Het
Eml6 T C 11: 29,791,993 H1130R probably damaging Het
Enox1 A T 14: 77,582,399 Y198F probably damaging Het
Epop A G 11: 97,628,728 L185P probably benign Het
Frem1 A T 4: 82,950,290 C1485S probably damaging Het
Gbf1 T A 19: 46,265,367 S571T probably benign Het
Gm5965 A T 16: 88,778,526 I196F probably null Het
Gm8237 T A 14: 5,863,642 I8L possibly damaging Het
Gria2 A C 3: 80,706,962 N590K probably damaging Het
Hectd2 T A 19: 36,612,233 probably null Het
Hmcn1 T A 1: 150,743,647 T1239S possibly damaging Het
Hps3 A T 3: 20,029,030 D167E probably damaging Het
Htr1a A G 13: 105,445,373 S374G probably benign Het
Il16 C T 7: 83,651,994 G307S probably benign Het
Ipmk T C 10: 71,381,217 F198S probably damaging Het
Lyz2 T A 10: 117,278,653 I124F probably damaging Het
Maea T C 5: 33,358,510 V47A probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrgpra1 A T 7: 47,335,272 C220S possibly damaging Het
Myo5c A T 9: 75,297,649 K1595* probably null Het
Naga G T 15: 82,330,094 D405E probably benign Het
Nanog T A 6: 122,713,459 N249K probably benign Het
Nhlh1 G T 1: 172,054,003 R99S probably damaging Het
Ntrk2 T A 13: 59,054,276 probably null Het
Nudt2 A G 4: 41,480,354 E79G probably benign Het
Olfr1313 A T 2: 112,071,668 M305K probably benign Het
Olfr1368 A T 13: 21,142,576 C160* probably null Het
Olfr666 T A 7: 104,892,873 I252F probably benign Het
Pitpnm2 T C 5: 124,129,401 D592G probably damaging Het
Prps1l3 T C 12: 57,238,583 V53A probably damaging Het
Psmd2 T G 16: 20,663,076 V853G probably damaging Het
Pycard A G 7: 127,993,505 I50T possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf168 T A 16: 32,278,403 S99T probably benign Het
Rph3al A G 11: 75,906,547 S108P possibly damaging Het
Sdk1 G A 5: 142,085,771 A979T probably benign Het
Sec16a G A 2: 26,441,356 Q216* probably null Het
Slc35f3 T A 8: 126,394,573 V391E possibly damaging Het
Slf1 T A 13: 77,051,265 I666F probably damaging Het
Slfn14 A G 11: 83,276,187 V834A probably damaging Het
Tab2 G A 10: 7,907,481 P679L probably damaging Het
Tbc1d10b A G 7: 127,200,283 probably null Het
Tmeff1 T A 4: 48,604,679 C91S probably damaging Het
Tmem108 G T 9: 103,489,282 N503K possibly damaging Het
Trbv29 A G 6: 41,271,607 T24A probably damaging Het
Trim34b A G 7: 104,331,239 E178G probably damaging Het
Trmt1l T A 1: 151,453,945 H546Q probably benign Het
Ttc39d A G 17: 80,216,370 I153V probably benign Het
Ttll13 T C 7: 80,250,216 V101A probably damaging Het
Ubash3b A T 9: 41,014,947 H501Q probably damaging Het
Upf3a T A 8: 13,796,443 probably null Het
Usp48 A G 4: 137,625,251 S94G probably benign Het
Wdr86 T C 5: 24,712,575 *381W probably null Het
Wdr90 G A 17: 25,855,352 P680S probably damaging Het
Zbtb22 G A 17: 33,916,982 V34M probably damaging Het
Zbtb8a A G 4: 129,359,896 probably null Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp512b A G 2: 181,589,502 V295A probably damaging Het
Zfp608 A T 18: 54,988,506 V3E possibly damaging Het
Zfp748 G T 13: 67,546,662 D32E possibly damaging Het
Other mutations in Csf3r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02059:Csf3r APN 4 126032127 nonsense probably null
IGL02224:Csf3r APN 4 126043539 missense probably benign 0.36
IGL02558:Csf3r APN 4 126038135 splice site probably benign
R0026:Csf3r UTSW 4 126031884 missense probably benign 0.33
R0033:Csf3r UTSW 4 126031884 missense probably benign 0.33
R0033:Csf3r UTSW 4 126031884 missense probably benign 0.33
R0121:Csf3r UTSW 4 126029849 missense probably benign 0.01
R0413:Csf3r UTSW 4 126039667 splice site probably benign
R0456:Csf3r UTSW 4 126035861 missense probably damaging 0.98
R0479:Csf3r UTSW 4 126043823 missense probably damaging 0.98
R1052:Csf3r UTSW 4 126042988 splice site probably null
R1466:Csf3r UTSW 4 126031932 splice site probably benign
R1512:Csf3r UTSW 4 126029984 missense possibly damaging 0.75
R1902:Csf3r UTSW 4 126042918 missense probably damaging 1.00
R1905:Csf3r UTSW 4 126042745 missense probably benign 0.12
R3424:Csf3r UTSW 4 126043756 missense probably damaging 1.00
R3705:Csf3r UTSW 4 126032285 missense possibly damaging 0.76
R3907:Csf3r UTSW 4 126034447 missense probably benign 0.00
R4514:Csf3r UTSW 4 126039860 missense possibly damaging 0.61
R4817:Csf3r UTSW 4 126037656 nonsense probably null
R5111:Csf3r UTSW 4 126030068 splice site probably null
R5120:Csf3r UTSW 4 126035827 missense probably benign 0.00
R5308:Csf3r UTSW 4 126035344 missense probably benign 0.00
R5912:Csf3r UTSW 4 126029960 missense probably damaging 1.00
R6018:Csf3r UTSW 4 126043621 missense probably benign 0.01
R6024:Csf3r UTSW 4 126037517 splice site probably null
R7144:Csf3r UTSW 4 126043722 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AAGGCTCAAGAAAGTAAATGTCCT -3'
(R):5'- CATTGCAGTCTCTCCCCAAG -3'

Sequencing Primer
(F):5'- AGAGGTCCTGAGTTCAATTCCCAG -3'
(R):5'- AGGCCACTACCCAGCTTCTG -3'
Posted On2014-12-04