Incidental Mutation 'R2520:Usp48'
ID254326
Institutional Source Beutler Lab
Gene Symbol Usp48
Ensembl Gene ENSMUSG00000043411
Gene Nameubiquitin specific peptidase 48
SynonymsUsp31, D330022K21Rik, 2810449C13Rik
MMRRC Submission 040424-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.901) question?
Stock #R2520 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location137593755-137658537 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 137625251 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 94 (S94G)
Ref Sequence ENSEMBL: ENSMUSP00000101464 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055131] [ENSMUST00000105837] [ENSMUST00000105838] [ENSMUST00000105839] [ENSMUST00000105840]
Predicted Effect probably benign
Transcript: ENSMUST00000055131
AA Change: S618G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000055016
Gene: ENSMUSG00000043411
AA Change: S618G

DomainStartEndE-ValueType
Pfam:UCH 88 417 6.9e-44 PFAM
Pfam:UCH_1 89 374 1e-22 PFAM
Blast:DUSP 479 555 5e-39 BLAST
coiled coil region 622 643 N/A INTRINSIC
UBQ 954 1022 4.78e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105837
AA Change: S93G

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000101463
Gene: ENSMUSG00000043411
AA Change: S93G

DomainStartEndE-ValueType
Blast:DUSP 1 30 3e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000105838
AA Change: S94G

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000101464
Gene: ENSMUSG00000043411
AA Change: S94G

DomainStartEndE-ValueType
Blast:DUSP 1 30 3e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000105839
AA Change: S619G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000101465
Gene: ENSMUSG00000043411
AA Change: S619G

DomainStartEndE-ValueType
Pfam:UCH 88 418 3.2e-47 PFAM
Pfam:UCH_1 89 374 1.1e-25 PFAM
Blast:DUSP 480 556 5e-40 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000105840
AA Change: S620G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101466
Gene: ENSMUSG00000043411
AA Change: S620G

DomainStartEndE-ValueType
Pfam:UCH 88 418 6.4e-49 PFAM
Pfam:UCH_1 89 374 1.8e-27 PFAM
Blast:DUSP 480 556 4e-39 BLAST
coiled coil region 624 645 N/A INTRINSIC
Blast:DUSP 743 824 2e-7 BLAST
UBQ 938 1006 4.78e-1 SMART
Predicted Effect unknown
Transcript: ENSMUST00000128065
AA Change: S37G
SMART Domains Protein: ENSMUSP00000115533
Gene: ENSMUSG00000043411
AA Change: S37G

DomainStartEndE-ValueType
Blast:DUSP 9 111 2e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138599
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154395
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing domains that associate it with the peptidase family C19, also known as family 2 of ubiquitin carboxyl-terminal hydrolases. Family members function as deubiquitinating enzymes, recognizing and hydrolyzing the peptide bond at the C-terminal glycine of ubiquitin. Enzymes in peptidase family C19 are involved in the processing of poly-ubiquitin precursors as well as that of ubiquitinated proteins. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700109H08Rik A T 5: 3,575,773 N70I probably damaging Het
4930503B20Rik G A 3: 146,650,506 R216W probably damaging Het
Abcb9 C T 5: 124,080,028 probably null Het
Arhgdia A T 11: 120,580,026 V72E probably damaging Het
Arsb A T 13: 93,940,699 K525* probably null Het
Bckdha A C 7: 25,641,699 I79S probably benign Het
Carm1 G A 9: 21,583,597 probably null Het
Cers5 G A 15: 99,736,381 T362I probably damaging Het
Clec4b2 T A 6: 123,200,983 F86I probably damaging Het
Crispld1 G A 1: 17,750,776 D347N probably damaging Het
Csf3r A T 4: 126,035,352 T352S probably benign Het
Daam2 G A 17: 49,480,757 Q443* probably null Het
Dcbld1 A G 10: 52,319,545 D283G probably damaging Het
Dpp9 T C 17: 56,206,868 E82G probably damaging Het
Dync1li1 A G 9: 114,689,006 D42G probably null Het
Eml6 T C 11: 29,791,993 H1130R probably damaging Het
Enox1 A T 14: 77,582,399 Y198F probably damaging Het
Epop A G 11: 97,628,728 L185P probably benign Het
Frem1 A T 4: 82,950,290 C1485S probably damaging Het
Gbf1 T A 19: 46,265,367 S571T probably benign Het
Gm5965 A T 16: 88,778,526 I196F probably null Het
Gm8237 T A 14: 5,863,642 I8L possibly damaging Het
Gria2 A C 3: 80,706,962 N590K probably damaging Het
Hectd2 T A 19: 36,612,233 probably null Het
Hmcn1 T A 1: 150,743,647 T1239S possibly damaging Het
Hps3 A T 3: 20,029,030 D167E probably damaging Het
Htr1a A G 13: 105,445,373 S374G probably benign Het
Il16 C T 7: 83,651,994 G307S probably benign Het
Ipmk T C 10: 71,381,217 F198S probably damaging Het
Lyz2 T A 10: 117,278,653 I124F probably damaging Het
Maea T C 5: 33,358,510 V47A probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrgpra1 A T 7: 47,335,272 C220S possibly damaging Het
Myo5c A T 9: 75,297,649 K1595* probably null Het
Naga G T 15: 82,330,094 D405E probably benign Het
Nanog T A 6: 122,713,459 N249K probably benign Het
Nhlh1 G T 1: 172,054,003 R99S probably damaging Het
Ntrk2 T A 13: 59,054,276 probably null Het
Nudt2 A G 4: 41,480,354 E79G probably benign Het
Olfr1313 A T 2: 112,071,668 M305K probably benign Het
Olfr1368 A T 13: 21,142,576 C160* probably null Het
Olfr666 T A 7: 104,892,873 I252F probably benign Het
Pitpnm2 T C 5: 124,129,401 D592G probably damaging Het
Prps1l3 T C 12: 57,238,583 V53A probably damaging Het
Psmd2 T G 16: 20,663,076 V853G probably damaging Het
Pycard A G 7: 127,993,505 I50T possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf168 T A 16: 32,278,403 S99T probably benign Het
Rph3al A G 11: 75,906,547 S108P possibly damaging Het
Sdk1 G A 5: 142,085,771 A979T probably benign Het
Sec16a G A 2: 26,441,356 Q216* probably null Het
Slc35f3 T A 8: 126,394,573 V391E possibly damaging Het
Slf1 T A 13: 77,051,265 I666F probably damaging Het
Slfn14 A G 11: 83,276,187 V834A probably damaging Het
Tab2 G A 10: 7,907,481 P679L probably damaging Het
Tbc1d10b A G 7: 127,200,283 probably null Het
Tmeff1 T A 4: 48,604,679 C91S probably damaging Het
Tmem108 G T 9: 103,489,282 N503K possibly damaging Het
Trbv29 A G 6: 41,271,607 T24A probably damaging Het
Trim34b A G 7: 104,331,239 E178G probably damaging Het
Trmt1l T A 1: 151,453,945 H546Q probably benign Het
Ttc39d A G 17: 80,216,370 I153V probably benign Het
Ttll13 T C 7: 80,250,216 V101A probably damaging Het
Ubash3b A T 9: 41,014,947 H501Q probably damaging Het
Upf3a T A 8: 13,796,443 probably null Het
Wdr86 T C 5: 24,712,575 *381W probably null Het
Wdr90 G A 17: 25,855,352 P680S probably damaging Het
Zbtb22 G A 17: 33,916,982 V34M probably damaging Het
Zbtb8a A G 4: 129,359,896 probably null Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp512b A G 2: 181,589,502 V295A probably damaging Het
Zfp608 A T 18: 54,988,506 V3E possibly damaging Het
Zfp748 G T 13: 67,546,662 D32E possibly damaging Het
Other mutations in Usp48
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01691:Usp48 APN 4 137623272 critical splice acceptor site probably null
IGL01864:Usp48 APN 4 137639227 missense possibly damaging 0.87
IGL02386:Usp48 APN 4 137604523 missense possibly damaging 0.93
IGL03112:Usp48 APN 4 137608064 missense probably damaging 1.00
IGL03114:Usp48 APN 4 137656125 missense probably damaging 1.00
IGL03406:Usp48 APN 4 137639295 missense possibly damaging 0.90
hayao UTSW 4 137633439 nonsense probably null
Mei UTSW 4 137606693 nonsense probably null
miyazaki UTSW 4 137608154 missense probably damaging 1.00
promise UTSW 4 137634921 missense probably damaging 1.00
satsuki UTSW 4 137633126 missense possibly damaging 0.93
totoro UTSW 4 137594483 missense probably damaging 0.99
IGL02796:Usp48 UTSW 4 137610718 missense probably damaging 1.00
R0050:Usp48 UTSW 4 137613803 missense probably damaging 1.00
R0333:Usp48 UTSW 4 137594483 missense probably damaging 0.99
R0382:Usp48 UTSW 4 137621218 missense probably benign 0.00
R0423:Usp48 UTSW 4 137616411 missense probably benign
R0570:Usp48 UTSW 4 137633126 missense possibly damaging 0.93
R0855:Usp48 UTSW 4 137608154 missense probably damaging 1.00
R0943:Usp48 UTSW 4 137644470 missense possibly damaging 0.92
R1367:Usp48 UTSW 4 137639295 missense possibly damaging 0.90
R1367:Usp48 UTSW 4 137644463 missense probably damaging 1.00
R1689:Usp48 UTSW 4 137656107 splice site probably null
R1725:Usp48 UTSW 4 137633422 nonsense probably null
R2965:Usp48 UTSW 4 137613762 missense probably damaging 1.00
R2966:Usp48 UTSW 4 137613762 missense probably damaging 1.00
R3026:Usp48 UTSW 4 137594444 missense probably benign 0.06
R3963:Usp48 UTSW 4 137633439 nonsense probably null
R4087:Usp48 UTSW 4 137623340 missense possibly damaging 0.95
R4633:Usp48 UTSW 4 137634900 missense probably damaging 0.96
R4677:Usp48 UTSW 4 137616381 missense probably benign 0.16
R4735:Usp48 UTSW 4 137633369 nonsense probably null
R4932:Usp48 UTSW 4 137615833 missense probably benign 0.00
R4932:Usp48 UTSW 4 137615834 intron probably null
R4935:Usp48 UTSW 4 137650358 missense probably benign 0.42
R4952:Usp48 UTSW 4 137606693 nonsense probably null
R5034:Usp48 UTSW 4 137606757 nonsense probably null
R5153:Usp48 UTSW 4 137616362 missense possibly damaging 0.68
R5443:Usp48 UTSW 4 137621221 missense possibly damaging 0.78
R5591:Usp48 UTSW 4 137652652 intron probably benign
R5825:Usp48 UTSW 4 137623378 missense probably benign
R5889:Usp48 UTSW 4 137616412 missense probably benign
R5955:Usp48 UTSW 4 137615818 missense probably benign
R6089:Usp48 UTSW 4 137605818 missense probably damaging 1.00
R6443:Usp48 UTSW 4 137613763 missense probably damaging 1.00
R6473:Usp48 UTSW 4 137609108 critical splice donor site probably null
R6482:Usp48 UTSW 4 137634921 missense probably damaging 1.00
R6859:Usp48 UTSW 4 137625276 missense possibly damaging 0.77
R6916:Usp48 UTSW 4 137638233 missense probably damaging 1.00
R6977:Usp48 UTSW 4 137650360 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTCACGTCAGCAATTG -3'
(R):5'- AGGGACACCAATCTGCAGAG -3'

Sequencing Primer
(F):5'- GCTCACGTCAGCAATTGGATTAAAC -3'
(R):5'- GCAACCACAGTAGCAGCTGG -3'
Posted On2014-12-04