Incidental Mutation 'R0317:Rasef'
ID25436
Institutional Source Beutler Lab
Gene Symbol Rasef
Ensembl Gene ENSMUSG00000043003
Gene NameRAS and EF hand domain containing
SynonymsRAB45
MMRRC Submission 038527-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R0317 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location73714579-73790994 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 73748562 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 160 (Q160R)
Ref Sequence ENSEMBL: ENSMUSP00000099901 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058292] [ENSMUST00000102837] [ENSMUST00000222414]
Predicted Effect probably damaging
Transcript: ENSMUST00000058292
AA Change: Q232R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000062771
Gene: ENSMUSG00000043003
AA Change: Q232R

DomainStartEndE-ValueType
low complexity region 20 34 N/A INTRINSIC
coiled coil region 55 251 N/A INTRINSIC
RAB 429 598 4.94e-69 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000102837
AA Change: Q160R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099901
Gene: ENSMUSG00000043003
AA Change: Q160R

DomainStartEndE-ValueType
coiled coil region 5 179 N/A INTRINSIC
RAB 357 526 4.94e-69 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000222414
AA Change: Q313R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Rab family of GTPases that are involved in regulation of membrane traffic. The encoded protein contains an N-terminal EF-hand domain, a coiled-coil motif and a C-terminal Rab domain. A potential role as tumor suppressor has been indicated for this gene. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,293,459 V1774A probably damaging Het
Adam34 G A 8: 43,652,251 P119L probably benign Het
Ap3b2 T C 7: 81,463,681 probably null Het
Arfip2 G A 7: 105,637,223 T124M probably damaging Het
Arhgef26 T C 3: 62,423,544 S560P probably damaging Het
Bcl11a A T 11: 24,172,697 probably null Het
Cab39 A G 1: 85,849,160 E322G probably damaging Het
Cad C A 5: 31,072,321 P1382Q probably benign Het
Cc2d2a T C 5: 43,706,901 probably null Het
Cela2a A T 4: 141,821,700 probably null Het
Ces1e A C 8: 93,224,039 I38S probably benign Het
Ces1f A T 8: 93,263,391 F364I probably benign Het
Chgb A G 2: 132,793,811 T558A probably benign Het
Cnpy4 C T 5: 138,192,812 Q217* probably null Het
Col4a3bp C T 13: 96,634,121 R487* probably null Het
Crlf1 A G 8: 70,498,599 T43A probably benign Het
Dnah7b T A 1: 46,134,656 M707K probably damaging Het
Ets2 G A 16: 95,712,149 S123N probably damaging Het
Fam196b C A 11: 34,402,826 D289E possibly damaging Het
Fry T C 5: 150,471,468 F304S probably damaging Het
Gadd45gip1 G A 8: 84,834,116 R120H probably benign Het
Gbf1 A G 19: 46,254,020 T96A probably benign Het
Ggn T A 7: 29,171,090 M1K probably null Het
Gm5239 A G 18: 35,536,916 T112A probably benign Het
Kif1bp A T 10: 62,578,082 probably null Het
Lrrc15 A T 16: 30,273,743 H259Q probably benign Het
Lysmd4 A G 7: 67,226,297 Y236C probably damaging Het
Med29 T C 7: 28,386,859 T175A possibly damaging Het
Mfsd12 G T 10: 81,357,799 D68Y probably damaging Het
Myh1 T C 11: 67,217,512 L1308P probably damaging Het
Nphp4 T A 4: 152,551,931 probably null Het
Olfr948 A G 9: 39,319,461 I51T probably benign Het
Pdhx A G 2: 103,028,280 V393A probably benign Het
Pgm5 A G 19: 24,824,399 I155T possibly damaging Het
Pgr A T 9: 8,965,022 I889F probably benign Het
Phactr4 T A 4: 132,386,930 K51I probably damaging Het
Pum2 T A 12: 8,728,754 I468K possibly damaging Het
Rab11a A G 9: 64,725,553 S24P probably damaging Het
Rbl2 A G 8: 91,087,144 D339G probably benign Het
Recql5 A G 11: 115,894,673 S666P probably benign Het
Rfc1 A T 5: 65,296,052 probably null Het
Scarb1 A G 5: 125,289,692 V59A probably damaging Het
Slc2a4 C T 11: 69,946,356 V85M probably damaging Het
Slc6a12 A G 6: 121,358,625 I291V possibly damaging Het
Slco3a1 A C 7: 74,504,426 Y104D probably damaging Het
Suz12 T A 11: 79,999,078 D13E probably damaging Het
Tlr1 G T 5: 64,925,967 C422* probably null Het
Tmco1 T C 1: 167,325,893 V114A probably damaging Het
Trpa1 T C 1: 14,881,632 T948A probably benign Het
Tub A T 7: 109,020,927 N93Y probably damaging Het
Ufsp2 G A 8: 45,992,233 probably null Het
Veph1 T C 3: 66,171,975 D373G probably benign Het
Vmn1r206 A G 13: 22,620,960 S26P possibly damaging Het
Vmn2r1 T C 3: 64,081,819 S60P possibly damaging Het
Wdcp A G 12: 4,851,583 S480G probably benign Het
Wnk4 T C 11: 101,268,804 S612P probably benign Het
Zfp503 T C 14: 21,986,459 K130E probably benign Het
Zkscan16 G A 4: 58,957,602 C628Y possibly damaging Het
Other mutations in Rasef
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00430:Rasef APN 4 73771425 nonsense probably null
IGL01329:Rasef APN 4 73727645 missense probably damaging 1.00
IGL01517:Rasef APN 4 73769822 missense probably benign 0.03
IGL02465:Rasef APN 4 73734488 missense probably damaging 1.00
IGL02676:Rasef APN 4 73759729 missense possibly damaging 0.69
IGL03137:Rasef APN 4 73734483 nonsense probably null
IGL03403:Rasef APN 4 73734534 missense probably damaging 1.00
P0033:Rasef UTSW 4 73749852 missense probably benign 0.26
R0035:Rasef UTSW 4 73762854 splice site probably benign
R0035:Rasef UTSW 4 73762854 splice site probably benign
R0686:Rasef UTSW 4 73734534 missense probably damaging 1.00
R0987:Rasef UTSW 4 73734484 nonsense probably null
R1115:Rasef UTSW 4 73748604 missense possibly damaging 0.85
R1511:Rasef UTSW 4 73735748 missense probably damaging 1.00
R1585:Rasef UTSW 4 73740337 missense probably damaging 1.00
R1646:Rasef UTSW 4 73734549 missense probably damaging 1.00
R1705:Rasef UTSW 4 73744064 nonsense probably null
R1918:Rasef UTSW 4 73744114 missense possibly damaging 0.94
R1919:Rasef UTSW 4 73744114 missense possibly damaging 0.94
R3819:Rasef UTSW 4 73759705 missense probably damaging 1.00
R3891:Rasef UTSW 4 73780397 missense probably benign 0.03
R3892:Rasef UTSW 4 73780397 missense probably benign 0.03
R4344:Rasef UTSW 4 73745089 missense probably damaging 1.00
R4491:Rasef UTSW 4 73734503 missense probably damaging 1.00
R4492:Rasef UTSW 4 73734503 missense probably damaging 1.00
R4594:Rasef UTSW 4 73780389 missense possibly damaging 0.47
R4915:Rasef UTSW 4 73731459 missense probably damaging 1.00
R5276:Rasef UTSW 4 73735767 missense probably null 1.00
R5359:Rasef UTSW 4 73771328 missense probably damaging 1.00
R5682:Rasef UTSW 4 73740971 nonsense probably null
R5693:Rasef UTSW 4 73769839 missense probably damaging 0.99
R6414:Rasef UTSW 4 73740581 missense probably benign 0.13
R6543:Rasef UTSW 4 73780519 intron probably benign
R6593:Rasef UTSW 4 73745090 missense probably damaging 1.00
R7078:Rasef UTSW 4 73780389 missense probably benign 0.01
R7083:Rasef UTSW 4 73790984 missense probably benign 0.26
R7106:Rasef UTSW 4 73727627 missense probably damaging 1.00
R7127:Rasef UTSW 4 73744132 missense probably damaging 1.00
R7329:Rasef UTSW 4 73744137 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATTCACTCGTGGACCTGAGGAG -3'
(R):5'- TAGTGATGAGTTTGCCCACACCCC -3'

Sequencing Primer
(F):5'- GTGAAGGGCACCTTCCTAACAG -3'
(R):5'- CCCATGATCACACCTGCTG -3'
Posted On2013-04-16