Incidental Mutation 'R2843:Kcnn3'
ID 254373
Institutional Source Beutler Lab
Gene Symbol Kcnn3
Ensembl Gene ENSMUSG00000000794
Gene Name potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3
Synonyms SK3, small conductance calcium-activated potassium channel 3
Accession Numbers
Essential gene? Possibly essential (E-score: 0.514) question?
Stock # R2843 (G1)
Quality Score 130
Status Not validated
Chromosome 3
Chromosomal Location 89427471-89579801 bp(+) (GRCm39)
Type of Mutation small deletion (1 aa in frame mutation)
DNA Base Change (assembly) CGCAGCAGCAGCAGCAGCAGCAG to CGCAGCAGCAGCAGCAGCAG at 89427972 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000000811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000811]
AlphaFold P58391
Predicted Effect probably benign
Transcript: ENSMUST00000000811
SMART Domains Protein: ENSMUSP00000000811
Gene: ENSMUSG00000000794

DomainStartEndE-ValueType
low complexity region 30 96 N/A INTRINSIC
low complexity region 139 154 N/A INTRINSIC
low complexity region 213 224 N/A INTRINSIC
Pfam:SK_channel 270 383 3.1e-51 PFAM
Pfam:Ion_trans_2 462 548 2.2e-14 PFAM
CaMBD 562 638 1.04e-49 SMART
low complexity region 684 690 N/A INTRINSIC
low complexity region 718 731 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. This gene belongs to the KCNN family of potassium channels. It encodes an integral membrane protein that forms a voltage-independent calcium-activated channel, which is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene contains two CAG repeat regions in the coding sequence. It was thought that expansion of one or both of these repeats could lead to an increased susceptibility to schizophrenia or bipolar disorder, but studies indicate that this is probably not the case. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for an insertion of a tetracycline-regulated gene switch display no overt phenotype when expression is abolished by doxycycline treatment; in contrast, untreated homozygotes show abnormal respiratory responses to hypoxia, impaired parturition, and pregnancy-related premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 16 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afm C T 5: 90,674,324 (GRCm39) R279* probably null Het
Arhgef18 A G 8: 3,414,634 (GRCm39) E4G possibly damaging Het
Fbxw7 G A 3: 84,883,527 (GRCm39) R486Q probably damaging Het
Fhad1 G T 4: 141,632,279 (GRCm39) Q1287K probably benign Het
Hmg20b G C 10: 81,182,404 (GRCm39) R209G probably benign Het
Hydin T C 8: 111,245,746 (GRCm39) V2153A probably benign Het
Jade1 T C 3: 41,559,280 (GRCm39) Y454H probably damaging Het
Pdlim2 C T 14: 70,403,549 (GRCm39) V288I probably benign Het
Pknox2 T C 9: 36,805,624 (GRCm39) N395S probably benign Het
Ppfia3 C A 7: 45,005,852 (GRCm39) R348L probably damaging Het
Rad51 T C 2: 118,949,114 (GRCm39) V38A probably benign Het
Sla2 G A 2: 156,717,862 (GRCm39) R137C probably damaging Het
Slc15a4 A G 5: 127,681,600 (GRCm39) probably null Het
Vmn2r18 T A 5: 151,485,749 (GRCm39) T582S probably damaging Het
Zbtb8os A T 4: 129,235,309 (GRCm39) E54D probably damaging Het
Zfp84 T G 7: 29,474,758 (GRCm39) probably null Het
Other mutations in Kcnn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02263:Kcnn3 APN 3 89,568,525 (GRCm39) missense possibly damaging 0.73
IGL02444:Kcnn3 APN 3 89,559,359 (GRCm39) missense possibly damaging 0.50
IGL02500:Kcnn3 APN 3 89,568,419 (GRCm39) splice site probably benign
IGL02814:Kcnn3 APN 3 89,428,482 (GRCm39) missense possibly damaging 0.94
IGL02821:Kcnn3 APN 3 89,428,281 (GRCm39) missense possibly damaging 0.91
IGL02821:Kcnn3 APN 3 89,570,029 (GRCm39) missense possibly damaging 0.84
IGL02852:Kcnn3 APN 3 89,516,923 (GRCm39) missense probably damaging 0.96
IGL02942:Kcnn3 APN 3 89,559,383 (GRCm39) missense probably benign 0.00
IGL03118:Kcnn3 APN 3 89,574,468 (GRCm39) missense probably damaging 1.00
R0015:Kcnn3 UTSW 3 89,570,080 (GRCm39) missense probably damaging 1.00
R0015:Kcnn3 UTSW 3 89,570,080 (GRCm39) missense probably damaging 1.00
R0032:Kcnn3 UTSW 3 89,427,972 (GRCm39) small deletion probably benign
R0370:Kcnn3 UTSW 3 89,574,399 (GRCm39) missense probably damaging 0.98
R0619:Kcnn3 UTSW 3 89,559,337 (GRCm39) missense probably damaging 1.00
R1167:Kcnn3 UTSW 3 89,472,259 (GRCm39) nonsense probably null
R1255:Kcnn3 UTSW 3 89,559,416 (GRCm39) missense possibly damaging 0.84
R1643:Kcnn3 UTSW 3 89,427,804 (GRCm39) missense unknown
R1733:Kcnn3 UTSW 3 89,559,397 (GRCm39) missense probably benign 0.00
R1793:Kcnn3 UTSW 3 89,516,712 (GRCm39) missense probably benign 0.20
R1827:Kcnn3 UTSW 3 89,428,301 (GRCm39) missense possibly damaging 0.75
R1899:Kcnn3 UTSW 3 89,427,762 (GRCm39) start gained probably benign
R2055:Kcnn3 UTSW 3 89,428,682 (GRCm39) missense probably damaging 1.00
R2922:Kcnn3 UTSW 3 89,428,329 (GRCm39) missense probably damaging 1.00
R4078:Kcnn3 UTSW 3 89,568,495 (GRCm39) missense possibly damaging 0.68
R4227:Kcnn3 UTSW 3 89,428,482 (GRCm39) missense possibly damaging 0.94
R4604:Kcnn3 UTSW 3 89,427,727 (GRCm39) start gained probably benign
R4814:Kcnn3 UTSW 3 89,570,031 (GRCm39) missense probably damaging 1.00
R4822:Kcnn3 UTSW 3 89,574,596 (GRCm39) missense possibly damaging 0.93
R5175:Kcnn3 UTSW 3 89,516,746 (GRCm39) missense probably damaging 1.00
R5211:Kcnn3 UTSW 3 89,428,538 (GRCm39) missense probably benign 0.04
R5438:Kcnn3 UTSW 3 89,428,605 (GRCm39) missense probably damaging 1.00
R5496:Kcnn3 UTSW 3 89,516,797 (GRCm39) missense possibly damaging 0.95
R6244:Kcnn3 UTSW 3 89,552,830 (GRCm39) nonsense probably null
R7391:Kcnn3 UTSW 3 89,516,778 (GRCm39) missense probably benign 0.34
R7625:Kcnn3 UTSW 3 89,516,977 (GRCm39) missense probably damaging 0.99
R7834:Kcnn3 UTSW 3 89,428,661 (GRCm39) missense probably damaging 1.00
R8022:Kcnn3 UTSW 3 89,517,010 (GRCm39) missense possibly damaging 0.92
R8110:Kcnn3 UTSW 3 89,568,540 (GRCm39) missense probably damaging 0.99
R8220:Kcnn3 UTSW 3 89,568,548 (GRCm39) missense probably benign 0.14
R8787:Kcnn3 UTSW 3 89,552,757 (GRCm39) missense possibly damaging 0.93
R9124:Kcnn3 UTSW 3 89,428,536 (GRCm39) missense possibly damaging 0.47
R9256:Kcnn3 UTSW 3 89,574,407 (GRCm39) missense probably damaging 1.00
R9612:Kcnn3 UTSW 3 89,516,703 (GRCm39) missense probably benign 0.09
Z1088:Kcnn3 UTSW 3 89,574,437 (GRCm39) missense probably damaging 1.00
Z1177:Kcnn3 UTSW 3 89,568,443 (GRCm39) missense possibly damaging 0.72
Z1177:Kcnn3 UTSW 3 89,428,230 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGACACTTCTGGGCACTTC -3'
(R):5'- TTGAGATTTAGCTGGCTGCC -3'

Sequencing Primer
(F):5'- TGGGCACTTCCATGACTCG -3'
(R):5'- TGCCTTGCCTGGAGGAAG -3'
Posted On 2014-12-04