Incidental Mutation 'R2520:Dpp9'
ID254423
Institutional Source Beutler Lab
Gene Symbol Dpp9
Ensembl Gene ENSMUSG00000001229
Gene Namedipeptidylpeptidase 9
SynonymsDPRP2, 6430584G11Rik
MMRRC Submission 040424-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2520 (G1)
Quality Score178
Status Not validated
Chromosome17
Chromosomal Location56186807-56218889 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 56206868 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 82 (E82G)
Ref Sequence ENSEMBL: ENSMUSP00000046604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038794]
Predicted Effect probably damaging
Transcript: ENSMUST00000038794
AA Change: E82G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000046604
Gene: ENSMUSG00000001229
AA Change: E82G

DomainStartEndE-ValueType
low complexity region 122 133 N/A INTRINSIC
Pfam:DPPIV_N 145 569 5.2e-109 PFAM
Pfam:Peptidase_S15 617 793 2.8e-10 PFAM
Pfam:Peptidase_S9 657 862 2.5e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223616
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the S9B family in clan SC of the serine proteases. The protein has been shown to have post-proline dipeptidyl aminopeptidase activity, cleaving Xaa-Pro dipeptides from the N-termini of proteins. Although the activity of this protein is similar to that of dipeptidyl peptidase 4 (DPP4), it does not appear to be membrane bound. In general, dipeptidyl peptidases appear to be involved in the regulation of the activity of their substrates and have been linked to a variety of diseases including type 2 diabetes, obesity and cancer. Several transcript variants of this gene have been described but not fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants display partial neonatal lethality and complete lethality at preweaning stages with defects suckling due to undeveveloped tongue muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700109H08Rik A T 5: 3,575,773 N70I probably damaging Het
4930503B20Rik G A 3: 146,650,506 R216W probably damaging Het
Abcb9 C T 5: 124,080,028 probably null Het
Arhgdia A T 11: 120,580,026 V72E probably damaging Het
Arsb A T 13: 93,940,699 K525* probably null Het
Bckdha A C 7: 25,641,699 I79S probably benign Het
Carm1 G A 9: 21,583,597 probably null Het
Cers5 G A 15: 99,736,381 T362I probably damaging Het
Clec4b2 T A 6: 123,200,983 F86I probably damaging Het
Crispld1 G A 1: 17,750,776 D347N probably damaging Het
Csf3r A T 4: 126,035,352 T352S probably benign Het
Daam2 G A 17: 49,480,757 Q443* probably null Het
Dcbld1 A G 10: 52,319,545 D283G probably damaging Het
Dync1li1 A G 9: 114,689,006 D42G probably null Het
Eml6 T C 11: 29,791,993 H1130R probably damaging Het
Enox1 A T 14: 77,582,399 Y198F probably damaging Het
Epop A G 11: 97,628,728 L185P probably benign Het
Frem1 A T 4: 82,950,290 C1485S probably damaging Het
Gbf1 T A 19: 46,265,367 S571T probably benign Het
Gm5965 A T 16: 88,778,526 I196F probably null Het
Gm8237 T A 14: 5,863,642 I8L possibly damaging Het
Gria2 A C 3: 80,706,962 N590K probably damaging Het
Hectd2 T A 19: 36,612,233 probably null Het
Hmcn1 T A 1: 150,743,647 T1239S possibly damaging Het
Hps3 A T 3: 20,029,030 D167E probably damaging Het
Htr1a A G 13: 105,445,373 S374G probably benign Het
Il16 C T 7: 83,651,994 G307S probably benign Het
Ipmk T C 10: 71,381,217 F198S probably damaging Het
Lyz2 T A 10: 117,278,653 I124F probably damaging Het
Maea T C 5: 33,358,510 V47A probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Mrgpra1 A T 7: 47,335,272 C220S possibly damaging Het
Myo5c A T 9: 75,297,649 K1595* probably null Het
Naga G T 15: 82,330,094 D405E probably benign Het
Nanog T A 6: 122,713,459 N249K probably benign Het
Nhlh1 G T 1: 172,054,003 R99S probably damaging Het
Ntrk2 T A 13: 59,054,276 probably null Het
Nudt2 A G 4: 41,480,354 E79G probably benign Het
Olfr1313 A T 2: 112,071,668 M305K probably benign Het
Olfr1368 A T 13: 21,142,576 C160* probably null Het
Olfr666 T A 7: 104,892,873 I252F probably benign Het
Pitpnm2 T C 5: 124,129,401 D592G probably damaging Het
Prps1l3 T C 12: 57,238,583 V53A probably damaging Het
Psmd2 T G 16: 20,663,076 V853G probably damaging Het
Pycard A G 7: 127,993,505 I50T possibly damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf168 T A 16: 32,278,403 S99T probably benign Het
Rph3al A G 11: 75,906,547 S108P possibly damaging Het
Sdk1 G A 5: 142,085,771 A979T probably benign Het
Sec16a G A 2: 26,441,356 Q216* probably null Het
Slc35f3 T A 8: 126,394,573 V391E possibly damaging Het
Slf1 T A 13: 77,051,265 I666F probably damaging Het
Slfn14 A G 11: 83,276,187 V834A probably damaging Het
Tab2 G A 10: 7,907,481 P679L probably damaging Het
Tbc1d10b A G 7: 127,200,283 probably null Het
Tmeff1 T A 4: 48,604,679 C91S probably damaging Het
Tmem108 G T 9: 103,489,282 N503K possibly damaging Het
Trbv29 A G 6: 41,271,607 T24A probably damaging Het
Trim34b A G 7: 104,331,239 E178G probably damaging Het
Trmt1l T A 1: 151,453,945 H546Q probably benign Het
Ttc39d A G 17: 80,216,370 I153V probably benign Het
Ttll13 T C 7: 80,250,216 V101A probably damaging Het
Ubash3b A T 9: 41,014,947 H501Q probably damaging Het
Upf3a T A 8: 13,796,443 probably null Het
Usp48 A G 4: 137,625,251 S94G probably benign Het
Wdr86 T C 5: 24,712,575 *381W probably null Het
Wdr90 G A 17: 25,855,352 P680S probably damaging Het
Zbtb22 G A 17: 33,916,982 V34M probably damaging Het
Zbtb8a A G 4: 129,359,896 probably null Het
Zfhx4 C T 3: 5,403,358 P2859S probably benign Het
Zfp512b A G 2: 181,589,502 V295A probably damaging Het
Zfp608 A T 18: 54,988,506 V3E possibly damaging Het
Zfp748 G T 13: 67,546,662 D32E possibly damaging Het
Other mutations in Dpp9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Dpp9 APN 17 56205240 missense probably damaging 0.99
IGL00920:Dpp9 APN 17 56200599 missense probably benign 0.01
IGL01568:Dpp9 APN 17 56191159 missense probably benign
IGL01583:Dpp9 APN 17 56211666 missense probably benign 0.00
IGL01613:Dpp9 APN 17 56190713 missense probably benign
IGL03371:Dpp9 APN 17 56187377 missense probably benign 0.00
R0100:Dpp9 UTSW 17 56205854 missense possibly damaging 0.75
R0100:Dpp9 UTSW 17 56205854 missense possibly damaging 0.75
R0418:Dpp9 UTSW 17 56194404 splice site probably benign
R1163:Dpp9 UTSW 17 56199426 missense possibly damaging 0.90
R1680:Dpp9 UTSW 17 56190103 missense probably benign 0.00
R1709:Dpp9 UTSW 17 56194431 missense probably benign
R1762:Dpp9 UTSW 17 56188362 missense probably damaging 1.00
R1809:Dpp9 UTSW 17 56199038 missense probably damaging 1.00
R1853:Dpp9 UTSW 17 56202885 missense probably benign 0.00
R1854:Dpp9 UTSW 17 56202885 missense probably benign 0.00
R2162:Dpp9 UTSW 17 56199113 missense possibly damaging 0.81
R2205:Dpp9 UTSW 17 56199287 missense possibly damaging 0.87
R2301:Dpp9 UTSW 17 56194973 missense probably benign 0.00
R3831:Dpp9 UTSW 17 56199113 missense possibly damaging 0.81
R3833:Dpp9 UTSW 17 56199113 missense possibly damaging 0.81
R4364:Dpp9 UTSW 17 56187391 missense possibly damaging 0.79
R4737:Dpp9 UTSW 17 56198970 critical splice donor site probably null
R4740:Dpp9 UTSW 17 56198970 critical splice donor site probably null
R4741:Dpp9 UTSW 17 56205286 missense probably benign
R4798:Dpp9 UTSW 17 56191016 missense probably damaging 0.96
R4806:Dpp9 UTSW 17 56190030 missense probably damaging 1.00
R5375:Dpp9 UTSW 17 56189424 nonsense probably null
R5709:Dpp9 UTSW 17 56189393 missense probably benign
R5783:Dpp9 UTSW 17 56211655 missense probably damaging 0.98
R6454:Dpp9 UTSW 17 56206808 missense probably damaging 1.00
R6532:Dpp9 UTSW 17 56205854 missense possibly damaging 0.75
R6894:Dpp9 UTSW 17 56188321 missense probably damaging 1.00
X0065:Dpp9 UTSW 17 56195006 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AGGTCTTTGAGTCACCCTCC -3'
(R):5'- GGTGGATTCCTGTAGATTCAAGAC -3'

Sequencing Primer
(F):5'- TTGAGTCACCCTCCGTTGGAAG -3'
(R):5'- TTCCTGTAGATTCAAGACAGAGAG -3'
Posted On2014-12-04