Incidental Mutation 'R2566:Postn'
ID254444
Institutional Source Beutler Lab
Gene Symbol Postn
Ensembl Gene ENSMUSG00000027750
Gene Nameperiostin, osteoblast specific factor
Synonymsperi, A630052E07Rik, OSF-2, Osf2, Periostin
MMRRC Submission 040425-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2566 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location54361109-54391037 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 54376953 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 614 (S614T)
Ref Sequence ENSEMBL: ENSMUSP00000112735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073012] [ENSMUST00000081564] [ENSMUST00000107985] [ENSMUST00000117373]
Predicted Effect probably damaging
Transcript: ENSMUST00000073012
AA Change: S614T

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000072773
Gene: ENSMUSG00000027750
AA Change: S614T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 135 235 7.81e-30 SMART
FAS1 272 370 2.31e-32 SMART
FAS1 406 497 2.43e-17 SMART
FAS1 534 633 2.5e-28 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000081564
AA Change: S614T

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000080276
Gene: ENSMUSG00000027750
AA Change: S614T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 135 235 7.81e-30 SMART
FAS1 272 370 2.31e-32 SMART
FAS1 406 497 2.43e-17 SMART
FAS1 534 633 2.5e-28 SMART
low complexity region 669 680 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107985
AA Change: S614T

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000103619
Gene: ENSMUSG00000027750
AA Change: S614T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 135 235 7.81e-30 SMART
FAS1 272 370 2.31e-32 SMART
FAS1 406 497 2.43e-17 SMART
FAS1 534 633 2.5e-28 SMART
low complexity region 669 680 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117373
AA Change: S614T

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112735
Gene: ENSMUSG00000027750
AA Change: S614T

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 135 235 7.81e-30 SMART
FAS1 272 370 2.31e-32 SMART
FAS1 406 497 2.43e-17 SMART
FAS1 534 633 2.5e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000143258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145036
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted extracellular matrix protein that functions in tissue development and regeneration, including wound healing and ventricular remodeling following myocardial infarction. The encoded protein binds to integrins to support adhesion and migration of epithelial cells. This protein plays a role in cancer stem cell maintenance and metastasis. Mice lacking this gene exhibit cardiac valve disease, and skeletal and dental defects. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice display abnormalities of the enamel, periodontal ligament, ameloblasts, and incisors. For one allele changing the hardness of the food alters the severity of the abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,293,071 K408E probably damaging Het
2010315B03Rik T A 9: 124,293,153 K380N probably damaging Het
9230104M06Rik C T 12: 113,000,739 probably benign Het
Ahi1 T A 10: 20,970,911 C413* probably null Het
Alms1 T A 6: 85,622,482 M1430K possibly damaging Het
Ankrd52 G T 10: 128,389,351 A894S probably benign Het
Arhgap33 C A 7: 30,527,229 V494L probably damaging Het
Atic G T 1: 71,568,971 V275F probably damaging Het
Atoh1 T A 6: 64,729,684 V121E probably damaging Het
Atp5h T A 11: 115,416,038 probably null Het
Baiap2l2 A T 15: 79,261,974 probably null Het
Brca2 A T 5: 150,541,762 T1664S probably benign Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Celf3 ACAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCA 3: 94,488,230 probably benign Het
Cep350 A T 1: 155,959,718 probably null Het
Ces2g T C 8: 104,965,989 probably null Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyp2d34 A G 15: 82,616,167 F457S probably damaging Het
Disp3 T A 4: 148,241,423 T1293S probably damaging Het
Dock10 T A 1: 80,540,253 I1348F possibly damaging Het
Dsp A T 13: 38,196,404 H1776L probably damaging Het
Efhd1 A T 1: 87,309,755 Q228L possibly damaging Het
Entpd2 T A 2: 25,399,283 I259N probably benign Het
Fam149b A T 14: 20,375,510 M138L probably damaging Het
Fastkd5 T C 2: 130,616,365 K102E probably benign Het
Fzd7 C A 1: 59,484,536 T526K possibly damaging Het
G6pd2 T A 5: 61,808,987 I35N probably damaging Het
Gars T A 6: 55,065,563 M427K probably damaging Het
Gimap4 C T 6: 48,690,865 R57C probably damaging Het
Gm11232 C A 4: 71,757,785 W41L probably benign Het
Gm15737 T A 6: 92,879,720 C43* probably null Het
Gm853 A T 4: 130,209,888 L420Q probably benign Het
Gpr180 T C 14: 118,139,773 V62A probably benign Het
H2-M11 C T 17: 36,548,150 T194I possibly damaging Het
Jakmip3 A T 7: 138,989,468 E27V possibly damaging Het
Kcnq3 T C 15: 66,031,427 T145A probably damaging Het
Krt8 A G 15: 101,998,024 M350T probably benign Het
Krtap4-9 T A 11: 99,785,666 probably benign Het
Lbr G T 1: 181,836,127 D109E probably damaging Het
Med23 A G 10: 24,888,575 H42R probably damaging Het
Mgat5 A T 1: 127,307,004 M77L probably benign Het
Mlf1 A T 3: 67,384,586 N28I possibly damaging Het
Mroh3 A C 1: 136,198,126 L343R probably damaging Het
Mrpl37 T A 4: 107,064,493 I180F possibly damaging Het
Mrps27 T A 13: 99,400,328 C116* probably null Het
Muc6 A G 7: 141,640,384 S1354P possibly damaging Het
Myh7 A T 14: 54,983,242 D1033E probably damaging Het
Myo16 A T 8: 10,594,820 E1717D probably benign Het
Myo1g T A 11: 6,512,539 probably null Het
Olfr610 A G 7: 103,506,160 M262T probably benign Het
Olfr815 A C 10: 129,902,095 L205R probably damaging Het
Pan2 T C 10: 128,313,897 L576P probably damaging Het
Parp8 A G 13: 116,895,687 S278P possibly damaging Het
Pdk2 A G 11: 95,027,202 probably null Het
Phf1 T C 17: 26,937,088 S450P probably damaging Het
Pkd1l2 T C 8: 117,019,494 Y1919C probably damaging Het
Psmg1 A T 16: 95,982,195 Y213* probably null Het
Rab11b T A 17: 33,747,718 T203S probably benign Het
Rad54l2 T A 9: 106,703,626 T899S possibly damaging Het
Ramp2 TTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 11: 101,246,545 probably benign Het
Rapgef6 A G 11: 54,687,711 T1028A possibly damaging Het
Rbm6 A G 9: 107,791,998 S58P possibly damaging Het
Rreb1 G T 13: 37,929,792 A376S possibly damaging Het
Rsbn1l T A 5: 20,919,769 N345I probably benign Het
Sf3b2 A T 19: 5,275,090 S785T possibly damaging Het
Sh2b1 C T 7: 126,468,926 D519N probably damaging Het
Slitrk6 T C 14: 110,750,272 T668A probably benign Het
Stkld1 T A 2: 26,950,638 I444N probably damaging Het
Sucla2 A T 14: 73,552,804 probably benign Het
Tmem67 T A 4: 12,079,918 L190F probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trem2 G A 17: 48,351,835 W191* probably null Het
Ube2d4 A T 15: 58,846,679 noncoding transcript Het
Uimc1 G T 13: 55,075,804 D218E probably damaging Het
Wdr62 A T 7: 30,273,999 V95E probably damaging Het
Zfhx4 T C 3: 5,245,143 V862A probably damaging Het
Zfp462 T A 4: 55,008,522 S163T probably benign Het
Zfp704 T C 3: 9,609,493 D76G unknown Het
Other mutations in Postn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Postn APN 3 54373728 missense probably damaging 1.00
IGL00567:Postn APN 3 54384523 missense probably benign
IGL00742:Postn APN 3 54372894 missense possibly damaging 0.81
IGL00971:Postn APN 3 54369276 missense possibly damaging 0.88
IGL01105:Postn APN 3 54362710 missense probably damaging 1.00
IGL01460:Postn APN 3 54375158 unclassified probably benign
IGL01609:Postn APN 3 54369228 missense probably damaging 0.99
IGL01878:Postn APN 3 54383480 splice site probably null
IGL01885:Postn APN 3 54376034 unclassified probably benign
IGL02040:Postn APN 3 54362689 missense probably benign
IGL02431:Postn APN 3 54375096 missense probably damaging 0.99
IGL02578:Postn APN 3 54377204 missense possibly damaging 0.93
IGL02943:Postn APN 3 54377608 critical splice donor site probably null
IGL03307:Postn APN 3 54375127 missense probably benign 0.32
sticklike UTSW 3 54372106 missense probably damaging 1.00
R0117:Postn UTSW 3 54383481 splice site probably benign
R0270:Postn UTSW 3 54384550 missense probably damaging 0.98
R0410:Postn UTSW 3 54385277 missense possibly damaging 0.93
R0548:Postn UTSW 3 54367576 nonsense probably null
R0734:Postn UTSW 3 54362715 missense probably damaging 1.00
R1648:Postn UTSW 3 54376101 missense probably damaging 1.00
R1796:Postn UTSW 3 54373756 missense probably damaging 1.00
R1823:Postn UTSW 3 54385287 critical splice donor site probably null
R1938:Postn UTSW 3 54377612 splice site probably null
R2311:Postn UTSW 3 54385223 missense probably damaging 0.98
R2938:Postn UTSW 3 54370310 missense probably damaging 1.00
R4105:Postn UTSW 3 54376041 missense probably damaging 1.00
R4394:Postn UTSW 3 54370955 missense probably damaging 1.00
R4620:Postn UTSW 3 54376993 missense probably damaging 1.00
R4628:Postn UTSW 3 54372157 missense probably damaging 1.00
R4697:Postn UTSW 3 54375071 missense probably damaging 1.00
R4709:Postn UTSW 3 54384610 intron probably benign
R4952:Postn UTSW 3 54390315 utr 3 prime probably benign
R5303:Postn UTSW 3 54377597 missense probably damaging 1.00
R5704:Postn UTSW 3 54372106 missense probably damaging 1.00
R5902:Postn UTSW 3 54372089 missense probably benign 0.03
R5914:Postn UTSW 3 54373800 nonsense probably null
R6032:Postn UTSW 3 54376716 missense possibly damaging 0.53
R6032:Postn UTSW 3 54376716 missense possibly damaging 0.53
R6101:Postn UTSW 3 54372220 splice site probably null
R6105:Postn UTSW 3 54372220 splice site probably null
R6334:Postn UTSW 3 54385282 missense probably benign
R7131:Postn UTSW 3 54362635 missense probably damaging 1.00
R7322:Postn UTSW 3 54370280 missense probably damaging 1.00
X0004:Postn UTSW 3 54362694 missense probably damaging 1.00
X0022:Postn UTSW 3 54370840 missense probably benign 0.03
Z1088:Postn UTSW 3 54375127 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- AACCCGGAGTCACTAATATCCTG -3'
(R):5'- CGGAGATAAACACTCAGTGAGTATG -3'

Sequencing Primer
(F):5'- CGGAGTCACTAATATCCTGAAGAC -3'
(R):5'- CACTCAGTGAGTATGGTAAGAAAATG -3'
Posted On2014-12-04