Incidental Mutation 'R0317:Cnpy4'
ID25446
Institutional Source Beutler Lab
Gene Symbol Cnpy4
Ensembl Gene ENSMUSG00000036968
Gene Namecanopy FGF signaling regulator 4
Synonyms
MMRRC Submission 038527-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R0317 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location138187485-138193918 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 138192812 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 217 (Q217*)
Ref Sequence ENSEMBL: ENSMUSP00000106559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057773] [ENSMUST00000110932] [ENSMUST00000110934]
Predicted Effect probably benign
Transcript: ENSMUST00000057773
SMART Domains Protein: ENSMUSP00000052869
Gene: ENSMUSG00000049285

DomainStartEndE-ValueType
Lactamase_B 70 235 4.04e-6 SMART
Predicted Effect probably null
Transcript: ENSMUST00000110932
SMART Domains Protein: ENSMUSP00000106557
Gene: ENSMUSG00000036968

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:DUF3456 32 160 9.5e-37 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110934
AA Change: Q217*
SMART Domains Protein: ENSMUSP00000106559
Gene: ENSMUSG00000036968
AA Change: Q217*

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:DUF3456 43 202 3.4e-51 PFAM
low complexity region 218 230 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130126
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit male infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,293,459 V1774A probably damaging Het
Adam34 G A 8: 43,652,251 P119L probably benign Het
Ap3b2 T C 7: 81,463,681 probably null Het
Arfip2 G A 7: 105,637,223 T124M probably damaging Het
Arhgef26 T C 3: 62,423,544 S560P probably damaging Het
Bcl11a A T 11: 24,172,697 probably null Het
Cab39 A G 1: 85,849,160 E322G probably damaging Het
Cad C A 5: 31,072,321 P1382Q probably benign Het
Cc2d2a T C 5: 43,706,901 probably null Het
Cela2a A T 4: 141,821,700 probably null Het
Ces1e A C 8: 93,224,039 I38S probably benign Het
Ces1f A T 8: 93,263,391 F364I probably benign Het
Chgb A G 2: 132,793,811 T558A probably benign Het
Col4a3bp C T 13: 96,634,121 R487* probably null Het
Crlf1 A G 8: 70,498,599 T43A probably benign Het
Dnah7b T A 1: 46,134,656 M707K probably damaging Het
Ets2 G A 16: 95,712,149 S123N probably damaging Het
Fam196b C A 11: 34,402,826 D289E possibly damaging Het
Fry T C 5: 150,471,468 F304S probably damaging Het
Gadd45gip1 G A 8: 84,834,116 R120H probably benign Het
Gbf1 A G 19: 46,254,020 T96A probably benign Het
Ggn T A 7: 29,171,090 M1K probably null Het
Gm5239 A G 18: 35,536,916 T112A probably benign Het
Kif1bp A T 10: 62,578,082 probably null Het
Lrrc15 A T 16: 30,273,743 H259Q probably benign Het
Lysmd4 A G 7: 67,226,297 Y236C probably damaging Het
Med29 T C 7: 28,386,859 T175A possibly damaging Het
Mfsd12 G T 10: 81,357,799 D68Y probably damaging Het
Myh1 T C 11: 67,217,512 L1308P probably damaging Het
Nphp4 T A 4: 152,551,931 probably null Het
Olfr948 A G 9: 39,319,461 I51T probably benign Het
Pdhx A G 2: 103,028,280 V393A probably benign Het
Pgm5 A G 19: 24,824,399 I155T possibly damaging Het
Pgr A T 9: 8,965,022 I889F probably benign Het
Phactr4 T A 4: 132,386,930 K51I probably damaging Het
Pum2 T A 12: 8,728,754 I468K possibly damaging Het
Rab11a A G 9: 64,725,553 S24P probably damaging Het
Rasef T C 4: 73,748,562 Q160R probably damaging Het
Rbl2 A G 8: 91,087,144 D339G probably benign Het
Recql5 A G 11: 115,894,673 S666P probably benign Het
Rfc1 A T 5: 65,296,052 probably null Het
Scarb1 A G 5: 125,289,692 V59A probably damaging Het
Slc2a4 C T 11: 69,946,356 V85M probably damaging Het
Slc6a12 A G 6: 121,358,625 I291V possibly damaging Het
Slco3a1 A C 7: 74,504,426 Y104D probably damaging Het
Suz12 T A 11: 79,999,078 D13E probably damaging Het
Tlr1 G T 5: 64,925,967 C422* probably null Het
Tmco1 T C 1: 167,325,893 V114A probably damaging Het
Trpa1 T C 1: 14,881,632 T948A probably benign Het
Tub A T 7: 109,020,927 N93Y probably damaging Het
Ufsp2 G A 8: 45,992,233 probably null Het
Veph1 T C 3: 66,171,975 D373G probably benign Het
Vmn1r206 A G 13: 22,620,960 S26P possibly damaging Het
Vmn2r1 T C 3: 64,081,819 S60P possibly damaging Het
Wdcp A G 12: 4,851,583 S480G probably benign Het
Wnk4 T C 11: 101,268,804 S612P probably benign Het
Zfp503 T C 14: 21,986,459 K130E probably benign Het
Zkscan16 G A 4: 58,957,602 C628Y possibly damaging Het
Other mutations in Cnpy4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02247:Cnpy4 APN 5 138192863 missense probably benign 0.00
R0525:Cnpy4 UTSW 5 138192616 missense probably benign 0.45
R0549:Cnpy4 UTSW 5 138187637 missense possibly damaging 0.63
R0568:Cnpy4 UTSW 5 138192577 missense probably damaging 1.00
R1889:Cnpy4 UTSW 5 138192840 missense probably benign 0.06
R2285:Cnpy4 UTSW 5 138192825 unclassified probably null
R4272:Cnpy4 UTSW 5 138192591 missense probably damaging 0.98
R6682:Cnpy4 UTSW 5 138187722 critical splice donor site probably null
R7283:Cnpy4 UTSW 5 138192882 missense probably benign 0.00
X0065:Cnpy4 UTSW 5 138192592 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- TCCAGCATTTTCTCTGTGAGCGGC -3'
(R):5'- TGACCAATCGGTGCAGGTGAAGAC -3'

Sequencing Primer
(F):5'- CATGTGCTTCCAGCCTCTG -3'
(R):5'- CCTGAAGGCAAAACTTGCTTCTG -3'
Posted On2013-04-16