Incidental Mutation 'R2566:Alms1'
ID254464
Institutional Source Beutler Lab
Gene Symbol Alms1
Ensembl Gene ENSMUSG00000063810
Gene NameALMS1, centrosome and basal body associated
Synonyms
MMRRC Submission 040425-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2566 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location85587531-85702753 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85622482 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1430 (M1430K)
Ref Sequence ENSEMBL: ENSMUSP00000071904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072018] [ENSMUST00000213058]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072018
AA Change: M1430K

PolyPhen 2 Score 0.838 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000071904
Gene: ENSMUSG00000063810
AA Change: M1430K

DomainStartEndE-ValueType
coiled coil region 10 39 N/A INTRINSIC
low complexity region 67 80 N/A INTRINSIC
low complexity region 98 119 N/A INTRINSIC
Blast:MYSc 127 233 1e-21 BLAST
internal_repeat_3 408 511 2.48e-7 PROSPERO
internal_repeat_2 414 804 2.09e-12 PROSPERO
internal_repeat_1 438 834 4.54e-18 PROSPERO
internal_repeat_3 652 757 2.48e-7 PROSPERO
low complexity region 903 908 N/A INTRINSIC
internal_repeat_1 916 1385 4.54e-18 PROSPERO
internal_repeat_2 1024 1390 2.09e-12 PROSPERO
low complexity region 1572 1586 N/A INTRINSIC
low complexity region 2004 2017 N/A INTRINSIC
low complexity region 2760 2773 N/A INTRINSIC
low complexity region 2950 2968 N/A INTRINSIC
low complexity region 3013 3030 N/A INTRINSIC
Pfam:ALMS_motif 3125 3247 1.8e-42 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213058
AA Change: M1899K

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a large tandem-repeat domain as well as additional low complexity regions. The encoded protein functions in microtubule organization, particularly in the formation and maintanance of cilia. Mutations in this gene cause Alstrom syndrome. There is a pseudogene for this gene located adjacent in the same region of chromosome 2. Alternative splice variants have been described but their full length nature has not been determined. [provided by RefSeq, Apr 2014]
PHENOTYPE: Homozygous null mice display obesity starting after puberty, hypogonadism, hyperinsulinemia, male-specific hyperglycemia, retinal dysfunction, and late-onset hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,293,071 K408E probably damaging Het
2010315B03Rik T A 9: 124,293,153 K380N probably damaging Het
9230104M06Rik C T 12: 113,000,739 probably benign Het
Ahi1 T A 10: 20,970,911 C413* probably null Het
Ankrd52 G T 10: 128,389,351 A894S probably benign Het
Arhgap33 C A 7: 30,527,229 V494L probably damaging Het
Atic G T 1: 71,568,971 V275F probably damaging Het
Atoh1 T A 6: 64,729,684 V121E probably damaging Het
Atp5h T A 11: 115,416,038 probably null Het
Baiap2l2 A T 15: 79,261,974 probably null Het
Brca2 A T 5: 150,541,762 T1664S probably benign Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Celf3 ACAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCA 3: 94,488,230 probably benign Het
Cep350 A T 1: 155,959,718 probably null Het
Ces2g T C 8: 104,965,989 probably null Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyp2d34 A G 15: 82,616,167 F457S probably damaging Het
Disp3 T A 4: 148,241,423 T1293S probably damaging Het
Dock10 T A 1: 80,540,253 I1348F possibly damaging Het
Dsp A T 13: 38,196,404 H1776L probably damaging Het
Efhd1 A T 1: 87,309,755 Q228L possibly damaging Het
Entpd2 T A 2: 25,399,283 I259N probably benign Het
Fam149b A T 14: 20,375,510 M138L probably damaging Het
Fastkd5 T C 2: 130,616,365 K102E probably benign Het
Fzd7 C A 1: 59,484,536 T526K possibly damaging Het
G6pd2 T A 5: 61,808,987 I35N probably damaging Het
Gars T A 6: 55,065,563 M427K probably damaging Het
Gimap4 C T 6: 48,690,865 R57C probably damaging Het
Gm11232 C A 4: 71,757,785 W41L probably benign Het
Gm15737 T A 6: 92,879,720 C43* probably null Het
Gm853 A T 4: 130,209,888 L420Q probably benign Het
Gpr180 T C 14: 118,139,773 V62A probably benign Het
H2-M11 C T 17: 36,548,150 T194I possibly damaging Het
Jakmip3 A T 7: 138,989,468 E27V possibly damaging Het
Kcnq3 T C 15: 66,031,427 T145A probably damaging Het
Krt8 A G 15: 101,998,024 M350T probably benign Het
Krtap4-9 T A 11: 99,785,666 probably benign Het
Lbr G T 1: 181,836,127 D109E probably damaging Het
Med23 A G 10: 24,888,575 H42R probably damaging Het
Mgat5 A T 1: 127,307,004 M77L probably benign Het
Mlf1 A T 3: 67,384,586 N28I possibly damaging Het
Mroh3 A C 1: 136,198,126 L343R probably damaging Het
Mrpl37 T A 4: 107,064,493 I180F possibly damaging Het
Mrps27 T A 13: 99,400,328 C116* probably null Het
Muc6 A G 7: 141,640,384 S1354P possibly damaging Het
Myh7 A T 14: 54,983,242 D1033E probably damaging Het
Myo16 A T 8: 10,594,820 E1717D probably benign Het
Myo1g T A 11: 6,512,539 probably null Het
Olfr610 A G 7: 103,506,160 M262T probably benign Het
Olfr815 A C 10: 129,902,095 L205R probably damaging Het
Pan2 T C 10: 128,313,897 L576P probably damaging Het
Parp8 A G 13: 116,895,687 S278P possibly damaging Het
Pdk2 A G 11: 95,027,202 probably null Het
Phf1 T C 17: 26,937,088 S450P probably damaging Het
Pkd1l2 T C 8: 117,019,494 Y1919C probably damaging Het
Postn T A 3: 54,376,953 S614T probably damaging Het
Psmg1 A T 16: 95,982,195 Y213* probably null Het
Rab11b T A 17: 33,747,718 T203S probably benign Het
Rad54l2 T A 9: 106,703,626 T899S possibly damaging Het
Ramp2 TTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 11: 101,246,545 probably benign Het
Rapgef6 A G 11: 54,687,711 T1028A possibly damaging Het
Rbm6 A G 9: 107,791,998 S58P possibly damaging Het
Rreb1 G T 13: 37,929,792 A376S possibly damaging Het
Rsbn1l T A 5: 20,919,769 N345I probably benign Het
Sf3b2 A T 19: 5,275,090 S785T possibly damaging Het
Sh2b1 C T 7: 126,468,926 D519N probably damaging Het
Slitrk6 T C 14: 110,750,272 T668A probably benign Het
Stkld1 T A 2: 26,950,638 I444N probably damaging Het
Sucla2 A T 14: 73,552,804 probably benign Het
Tmem67 T A 4: 12,079,918 L190F probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trem2 G A 17: 48,351,835 W191* probably null Het
Ube2d4 A T 15: 58,846,679 noncoding transcript Het
Uimc1 G T 13: 55,075,804 D218E probably damaging Het
Wdr62 A T 7: 30,273,999 V95E probably damaging Het
Zfhx4 T C 3: 5,245,143 V862A probably damaging Het
Zfp462 T A 4: 55,008,522 S163T probably benign Het
Zfp704 T C 3: 9,609,493 D76G unknown Het
Other mutations in Alms1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Alms1 APN 6 85677964 missense probably damaging 1.00
IGL00331:Alms1 APN 6 85641371 missense possibly damaging 0.94
IGL00658:Alms1 APN 6 85628961 missense probably damaging 1.00
IGL00835:Alms1 APN 6 85622134 missense probably damaging 1.00
IGL00930:Alms1 APN 6 85601310 missense probably damaging 0.98
IGL01446:Alms1 APN 6 85696701 missense probably damaging 1.00
IGL01448:Alms1 APN 6 85677899 missense possibly damaging 0.93
IGL01563:Alms1 APN 6 85627983 missense probably damaging 1.00
IGL01632:Alms1 APN 6 85627946 missense probably benign 0.07
IGL01651:Alms1 APN 6 85656476 missense probably benign 0.05
IGL01670:Alms1 APN 6 85678150 missense probably benign 0.00
IGL01716:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01719:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01720:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01723:Alms1 APN 6 85628094 missense probably benign 0.01
IGL01877:Alms1 APN 6 85622411 missense possibly damaging 0.55
IGL01919:Alms1 APN 6 85628004 missense possibly damaging 0.77
IGL01976:Alms1 APN 6 85622665 missense possibly damaging 0.73
IGL02003:Alms1 APN 6 85622223 missense possibly damaging 0.54
IGL02069:Alms1 APN 6 85628823 missense probably benign 0.12
IGL02070:Alms1 APN 6 85651403 missense possibly damaging 0.74
IGL02079:Alms1 APN 6 85628634 missense probably damaging 0.98
IGL02081:Alms1 APN 6 85620303 missense possibly damaging 0.55
IGL02379:Alms1 APN 6 85629633 missense probably damaging 0.98
IGL02412:Alms1 APN 6 85628872 missense possibly damaging 0.91
IGL02606:Alms1 APN 6 85599967 missense probably benign
IGL02636:Alms1 APN 6 85628654 missense probably benign 0.28
IGL02702:Alms1 APN 6 85599849 missense probably benign 0.12
IGL02815:Alms1 APN 6 85667957 critical splice donor site probably null
IGL02926:Alms1 APN 6 85641450 missense probably damaging 1.00
IGL02945:Alms1 APN 6 85620933 missense probably damaging 0.96
IGL02959:Alms1 APN 6 85629052 nonsense probably null
IGL03124:Alms1 APN 6 85678419 missense probably benign 0.03
IGL03199:Alms1 APN 6 85622497 missense possibly damaging 0.68
IGL03209:Alms1 APN 6 85599973 splice site probably benign
IGL03247:Alms1 APN 6 85678597 missense possibly damaging 0.85
ares UTSW 6 85621275 nonsense probably null
ares2 UTSW 6 85677990 nonsense probably null
earthquake UTSW 6 85628735 nonsense probably null
fatty UTSW 6 85627934 nonsense probably null
gut_check UTSW 6 85620369 nonsense probably null
portly UTSW 6 85619712 missense probably benign 0.00
PIT4468001:Alms1 UTSW 6 85624719 critical splice donor site probably null
R0003:Alms1 UTSW 6 85629210 missense possibly damaging 0.90
R0095:Alms1 UTSW 6 85620253 missense possibly damaging 0.90
R0110:Alms1 UTSW 6 85620369 nonsense probably null
R0114:Alms1 UTSW 6 85619803 missense probably benign 0.00
R0153:Alms1 UTSW 6 85641381 missense possibly damaging 0.94
R0217:Alms1 UTSW 6 85622930 missense probably damaging 0.99
R0328:Alms1 UTSW 6 85610814 splice site probably null
R0410:Alms1 UTSW 6 85587803 missense unknown
R0469:Alms1 UTSW 6 85620369 nonsense probably null
R0491:Alms1 UTSW 6 85702600 missense probably damaging 0.98
R0510:Alms1 UTSW 6 85620369 nonsense probably null
R0522:Alms1 UTSW 6 85621615 missense probably benign
R0525:Alms1 UTSW 6 85587760 missense unknown
R0611:Alms1 UTSW 6 85678671 missense possibly damaging 0.61
R0637:Alms1 UTSW 6 85623033 missense possibly damaging 0.85
R0718:Alms1 UTSW 6 85621821 missense probably benign 0.00
R0831:Alms1 UTSW 6 85628520 missense probably benign 0.00
R1318:Alms1 UTSW 6 85628549 missense possibly damaging 0.62
R1340:Alms1 UTSW 6 85667957 critical splice donor site probably null
R1561:Alms1 UTSW 6 85629052 nonsense probably null
R1648:Alms1 UTSW 6 85678402 missense probably damaging 0.99
R1697:Alms1 UTSW 6 85622454 missense possibly damaging 0.94
R1699:Alms1 UTSW 6 85622880 missense possibly damaging 0.46
R1715:Alms1 UTSW 6 85629052 nonsense probably null
R1723:Alms1 UTSW 6 85628753 missense probably damaging 1.00
R1734:Alms1 UTSW 6 85641550 critical splice donor site probably null
R1758:Alms1 UTSW 6 85628505 missense probably damaging 0.99
R1804:Alms1 UTSW 6 85621275 nonsense probably null
R1835:Alms1 UTSW 6 85678503 missense possibly damaging 0.94
R1836:Alms1 UTSW 6 85678503 missense possibly damaging 0.94
R2077:Alms1 UTSW 6 85622309 missense possibly damaging 0.93
R2246:Alms1 UTSW 6 85622967 missense possibly damaging 0.91
R2254:Alms1 UTSW 6 85619848 missense probably damaging 1.00
R2280:Alms1 UTSW 6 85677973 missense probably damaging 0.99
R2516:Alms1 UTSW 6 85667963 splice site probably benign
R2519:Alms1 UTSW 6 85667963 splice site probably benign
R2850:Alms1 UTSW 6 85621299 missense probably benign 0.00
R2850:Alms1 UTSW 6 85667963 splice site probably benign
R2932:Alms1 UTSW 6 85620562 missense possibly damaging 0.89
R2944:Alms1 UTSW 6 85628391 missense probably damaging 1.00
R2980:Alms1 UTSW 6 85628835 missense probably damaging 1.00
R3084:Alms1 UTSW 6 85678140 missense probably benign
R3086:Alms1 UTSW 6 85678140 missense probably benign
R3122:Alms1 UTSW 6 85667963 splice site probably benign
R3404:Alms1 UTSW 6 85667963 splice site probably benign
R3405:Alms1 UTSW 6 85667963 splice site probably benign
R3804:Alms1 UTSW 6 85619647 missense probably damaging 1.00
R3904:Alms1 UTSW 6 85621678 missense probably benign 0.00
R4014:Alms1 UTSW 6 85678352 missense probably benign 0.41
R4056:Alms1 UTSW 6 85587803 missense unknown
R4067:Alms1 UTSW 6 85621289 missense probably damaging 1.00
R4110:Alms1 UTSW 6 85620888 missense probably benign 0.00
R4111:Alms1 UTSW 6 85620888 missense probably benign 0.00
R4112:Alms1 UTSW 6 85620888 missense probably benign 0.00
R4194:Alms1 UTSW 6 85677990 nonsense probably null
R4464:Alms1 UTSW 6 85620021 missense possibly damaging 0.66
R4539:Alms1 UTSW 6 85620478 missense possibly damaging 0.78
R4554:Alms1 UTSW 6 85624617 missense probably benign
R4696:Alms1 UTSW 6 85620522 missense probably damaging 1.00
R4825:Alms1 UTSW 6 85678245 missense probably damaging 0.99
R4921:Alms1 UTSW 6 85628546 missense probably benign 0.13
R5030:Alms1 UTSW 6 85627964 missense probably damaging 0.98
R5051:Alms1 UTSW 6 85627934 nonsense probably null
R5085:Alms1 UTSW 6 85620732 missense possibly damaging 0.55
R5141:Alms1 UTSW 6 85621432 missense probably benign 0.01
R5233:Alms1 UTSW 6 85656371 intron probably null
R5310:Alms1 UTSW 6 85615368 missense possibly damaging 0.79
R5344:Alms1 UTSW 6 85696789 missense probably benign 0.04
R5394:Alms1 UTSW 6 85623088 missense probably benign 0.01
R5460:Alms1 UTSW 6 85696731 missense probably benign 0.08
R5558:Alms1 UTSW 6 85641329 nonsense probably null
R5650:Alms1 UTSW 6 85620271 missense probably damaging 1.00
R5667:Alms1 UTSW 6 85696771 missense probably damaging 0.99
R5671:Alms1 UTSW 6 85629208 missense possibly damaging 0.87
R5688:Alms1 UTSW 6 85599895 missense possibly damaging 0.92
R5815:Alms1 UTSW 6 85622838 missense probably damaging 0.99
R5892:Alms1 UTSW 6 85620903 missense probably damaging 0.99
R5947:Alms1 UTSW 6 85619712 missense probably benign 0.00
R6031:Alms1 UTSW 6 85622955 missense probably damaging 1.00
R6031:Alms1 UTSW 6 85622955 missense probably damaging 1.00
R6144:Alms1 UTSW 6 85623074 missense probably damaging 0.98
R6258:Alms1 UTSW 6 85628735 nonsense probably null
R6260:Alms1 UTSW 6 85628735 nonsense probably null
R6455:Alms1 UTSW 6 85696657 missense probably damaging 0.99
R6569:Alms1 UTSW 6 85641339 missense probably benign 0.07
R6637:Alms1 UTSW 6 85619734 missense possibly damaging 0.78
R6866:Alms1 UTSW 6 85621098 missense possibly damaging 0.85
R6918:Alms1 UTSW 6 85622661 missense possibly damaging 0.87
R7121:Alms1 UTSW 6 85624622 missense probably damaging 1.00
R7179:Alms1 UTSW 6 85621369 missense probably benign 0.09
X0013:Alms1 UTSW 6 85656455 missense probably damaging 1.00
X0025:Alms1 UTSW 6 85620210 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACATGTCCAAGAGCTGATGG -3'
(R):5'- TGTGTGCCAATGTCCTTCTG -3'

Sequencing Primer
(F):5'- GGATAACTTGAATTCTTCCGAGTCG -3'
(R):5'- GTGCCAATGTCCTTCTGTACATATTC -3'
Posted On2014-12-04