Incidental Mutation 'R2566:Med23'
ID254483
Institutional Source Beutler Lab
Gene Symbol Med23
Ensembl Gene ENSMUSG00000019984
Gene Namemediator complex subunit 23
SynonymsX83317, 3000002A17Rik, ESTM7, Crsp3, Sur2
MMRRC Submission 040425-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2566 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location24869986-24913681 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24888575 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 42 (H42R)
Ref Sequence ENSEMBL: ENSMUSP00000135232 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020159] [ENSMUST00000092646] [ENSMUST00000176285] [ENSMUST00000176502] [ENSMUST00000177232]
Predicted Effect probably benign
Transcript: ENSMUST00000020159
AA Change: H354R

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000020159
Gene: ENSMUSG00000019984
AA Change: H354R

DomainStartEndE-ValueType
Pfam:Med23 3 1310 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092646
AA Change: H360R

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000090316
Gene: ENSMUSG00000019984
AA Change: H360R

DomainStartEndE-ValueType
Pfam:Med23 4 1316 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175786
Predicted Effect probably damaging
Transcript: ENSMUST00000176285
AA Change: H42R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135232
Gene: ENSMUSG00000019984
AA Change: H42R

DomainStartEndE-ValueType
Pfam:Med23 1 51 4.4e-14 PFAM
Pfam:Med23 48 950 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000176502
AA Change: H152R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134836
Gene: ENSMUSG00000019984
AA Change: H152R

DomainStartEndE-ValueType
Pfam:Med23 1 95 8.7e-36 PFAM
Pfam:Med23 92 234 3.8e-63 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176827
Predicted Effect probably benign
Transcript: ENSMUST00000177232
SMART Domains Protein: ENSMUSP00000134866
Gene: ENSMUSG00000019984

DomainStartEndE-ValueType
Pfam:Med23 3 58 1.2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177522
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. This protein also acts as a metastasis suppressor. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display embryonic lethality during organogenesis with disorganization of the vasculature and peripheral nervous system. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,293,071 K408E probably damaging Het
2010315B03Rik T A 9: 124,293,153 K380N probably damaging Het
9230104M06Rik C T 12: 113,000,739 probably benign Het
Ahi1 T A 10: 20,970,911 C413* probably null Het
Alms1 T A 6: 85,622,482 M1430K possibly damaging Het
Ankrd52 G T 10: 128,389,351 A894S probably benign Het
Arhgap33 C A 7: 30,527,229 V494L probably damaging Het
Atic G T 1: 71,568,971 V275F probably damaging Het
Atoh1 T A 6: 64,729,684 V121E probably damaging Het
Atp5h T A 11: 115,416,038 probably null Het
Baiap2l2 A T 15: 79,261,974 probably null Het
Brca2 A T 5: 150,541,762 T1664S probably benign Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Celf3 ACAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCA 3: 94,488,230 probably benign Het
Cep350 A T 1: 155,959,718 probably null Het
Ces2g T C 8: 104,965,989 probably null Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyp2d34 A G 15: 82,616,167 F457S probably damaging Het
Disp3 T A 4: 148,241,423 T1293S probably damaging Het
Dock10 T A 1: 80,540,253 I1348F possibly damaging Het
Dsp A T 13: 38,196,404 H1776L probably damaging Het
Efhd1 A T 1: 87,309,755 Q228L possibly damaging Het
Entpd2 T A 2: 25,399,283 I259N probably benign Het
Fam149b A T 14: 20,375,510 M138L probably damaging Het
Fastkd5 T C 2: 130,616,365 K102E probably benign Het
Fzd7 C A 1: 59,484,536 T526K possibly damaging Het
G6pd2 T A 5: 61,808,987 I35N probably damaging Het
Gars T A 6: 55,065,563 M427K probably damaging Het
Gimap4 C T 6: 48,690,865 R57C probably damaging Het
Gm11232 C A 4: 71,757,785 W41L probably benign Het
Gm15737 T A 6: 92,879,720 C43* probably null Het
Gm853 A T 4: 130,209,888 L420Q probably benign Het
Gpr180 T C 14: 118,139,773 V62A probably benign Het
H2-M11 C T 17: 36,548,150 T194I possibly damaging Het
Jakmip3 A T 7: 138,989,468 E27V possibly damaging Het
Kcnq3 T C 15: 66,031,427 T145A probably damaging Het
Krt8 A G 15: 101,998,024 M350T probably benign Het
Krtap4-9 T A 11: 99,785,666 probably benign Het
Lbr G T 1: 181,836,127 D109E probably damaging Het
Mgat5 A T 1: 127,307,004 M77L probably benign Het
Mlf1 A T 3: 67,384,586 N28I possibly damaging Het
Mroh3 A C 1: 136,198,126 L343R probably damaging Het
Mrpl37 T A 4: 107,064,493 I180F possibly damaging Het
Mrps27 T A 13: 99,400,328 C116* probably null Het
Muc6 A G 7: 141,640,384 S1354P possibly damaging Het
Myh7 A T 14: 54,983,242 D1033E probably damaging Het
Myo16 A T 8: 10,594,820 E1717D probably benign Het
Myo1g T A 11: 6,512,539 probably null Het
Olfr610 A G 7: 103,506,160 M262T probably benign Het
Olfr815 A C 10: 129,902,095 L205R probably damaging Het
Pan2 T C 10: 128,313,897 L576P probably damaging Het
Parp8 A G 13: 116,895,687 S278P possibly damaging Het
Pdk2 A G 11: 95,027,202 probably null Het
Phf1 T C 17: 26,937,088 S450P probably damaging Het
Pkd1l2 T C 8: 117,019,494 Y1919C probably damaging Het
Postn T A 3: 54,376,953 S614T probably damaging Het
Psmg1 A T 16: 95,982,195 Y213* probably null Het
Rab11b T A 17: 33,747,718 T203S probably benign Het
Rad54l2 T A 9: 106,703,626 T899S possibly damaging Het
Ramp2 TTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 11: 101,246,545 probably benign Het
Rapgef6 A G 11: 54,687,711 T1028A possibly damaging Het
Rbm6 A G 9: 107,791,998 S58P possibly damaging Het
Rreb1 G T 13: 37,929,792 A376S possibly damaging Het
Rsbn1l T A 5: 20,919,769 N345I probably benign Het
Sf3b2 A T 19: 5,275,090 S785T possibly damaging Het
Sh2b1 C T 7: 126,468,926 D519N probably damaging Het
Slitrk6 T C 14: 110,750,272 T668A probably benign Het
Stkld1 T A 2: 26,950,638 I444N probably damaging Het
Sucla2 A T 14: 73,552,804 probably benign Het
Tmem67 T A 4: 12,079,918 L190F probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trem2 G A 17: 48,351,835 W191* probably null Het
Ube2d4 A T 15: 58,846,679 noncoding transcript Het
Uimc1 G T 13: 55,075,804 D218E probably damaging Het
Wdr62 A T 7: 30,273,999 V95E probably damaging Het
Zfhx4 T C 3: 5,245,143 V862A probably damaging Het
Zfp462 T A 4: 55,008,522 S163T probably benign Het
Zfp704 T C 3: 9,609,493 D76G unknown Het
Other mutations in Med23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00670:Med23 APN 10 24888584 missense probably damaging 1.00
IGL00792:Med23 APN 10 24877004 missense possibly damaging 0.93
IGL01289:Med23 APN 10 24902121 missense probably damaging 1.00
IGL01469:Med23 APN 10 24882597 missense probably damaging 1.00
IGL01598:Med23 APN 10 24903798 missense probably benign 0.34
IGL02324:Med23 APN 10 24897341 missense probably damaging 0.98
IGL02381:Med23 APN 10 24900728 missense possibly damaging 0.95
IGL02465:Med23 APN 10 24903743 missense probably damaging 0.96
IGL02554:Med23 APN 10 24898575 critical splice donor site probably null
IGL02683:Med23 APN 10 24870717 missense probably benign 0.00
PIT4362001:Med23 UTSW 10 24874571 missense probably benign 0.01
R0080:Med23 UTSW 10 24912817 missense probably benign 0.33
R0125:Med23 UTSW 10 24900788 missense probably damaging 1.00
R0311:Med23 UTSW 10 24897358 missense possibly damaging 0.95
R0765:Med23 UTSW 10 24900710 missense probably damaging 1.00
R1302:Med23 UTSW 10 24888422 unclassified probably null
R1456:Med23 UTSW 10 24903652 splice site probably benign
R1514:Med23 UTSW 10 24892667 splice site probably benign
R1774:Med23 UTSW 10 24903686 missense probably damaging 1.00
R1851:Med23 UTSW 10 24910870 splice site probably null
R1928:Med23 UTSW 10 24909812 missense probably benign
R1975:Med23 UTSW 10 24910766 missense probably benign 0.01
R2011:Med23 UTSW 10 24879755 missense possibly damaging 0.63
R2266:Med23 UTSW 10 24874601 missense probably benign 0.00
R2309:Med23 UTSW 10 24870688 missense probably damaging 0.99
R2507:Med23 UTSW 10 24910813 missense probably damaging 1.00
R3720:Med23 UTSW 10 24891120 missense probably damaging 1.00
R3771:Med23 UTSW 10 24902201 missense probably damaging 1.00
R3811:Med23 UTSW 10 24892592 nonsense probably null
R3811:Med23 UTSW 10 24892593 splice site probably null
R4305:Med23 UTSW 10 24904270 nonsense probably null
R4323:Med23 UTSW 10 24870705 missense probably benign 0.02
R4701:Med23 UTSW 10 24893648 missense probably damaging 1.00
R4886:Med23 UTSW 10 24874683 critical splice donor site probably null
R4925:Med23 UTSW 10 24910747 missense probably damaging 1.00
R4943:Med23 UTSW 10 24875669 missense possibly damaging 0.92
R5207:Med23 UTSW 10 24895836 nonsense probably null
R5749:Med23 UTSW 10 24888449 missense possibly damaging 0.84
R5806:Med23 UTSW 10 24907221 missense probably damaging 1.00
R5896:Med23 UTSW 10 24902145 missense probably damaging 1.00
R5954:Med23 UTSW 10 24870483 splice site probably benign
R6031:Med23 UTSW 10 24903748 nonsense probably null
R6031:Med23 UTSW 10 24903748 nonsense probably null
R6093:Med23 UTSW 10 24878443 missense probably benign 0.16
R6107:Med23 UTSW 10 24906034 nonsense probably null
R6356:Med23 UTSW 10 24888413 missense probably damaging 0.98
R6393:Med23 UTSW 10 24873476 missense possibly damaging 0.91
R6533:Med23 UTSW 10 24893620 missense probably damaging 1.00
R6911:Med23 UTSW 10 24902181 missense probably damaging 0.98
R6981:Med23 UTSW 10 24895824 missense possibly damaging 0.92
R7085:Med23 UTSW 10 24870121 missense probably damaging 1.00
R7215:Med23 UTSW 10 24888429 missense probably benign
R7229:Med23 UTSW 10 24902004 missense probably benign
R7489:Med23 UTSW 10 24904356 missense probably damaging 1.00
R7653:Med23 UTSW 10 24904384 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGGAGGCTTTTGGAATACTG -3'
(R):5'- TGTGTGCGTGTACATTCCCC -3'

Sequencing Primer
(F):5'- ACTGTATGTAATCTCTGCCTACAG -3'
(R):5'- GGAAGACTCCTTAGTGGTACTAC -3'
Posted On2014-12-04