Incidental Mutation 'R2566:Olfr815'
ID254486
Institutional Source Beutler Lab
Gene Symbol Olfr815
Ensembl Gene ENSMUSG00000061961
Gene Nameolfactory receptor 815
SynonymsGA_x6K02T2PULF-11581263-11580331, MOR113-3
MMRRC Submission 040425-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R2566 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location129900570-129905867 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 129902095 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 205 (L205R)
Ref Sequence ENSEMBL: ENSMUSP00000151146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071557] [ENSMUST00000205013] [ENSMUST00000216182]
Predicted Effect probably damaging
Transcript: ENSMUST00000071557
AA Change: L211R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071488
Gene: ENSMUSG00000061961
AA Change: L211R

DomainStartEndE-ValueType
Pfam:7tm_4 35 313 4.2e-45 PFAM
Pfam:7tm_1 45 294 1.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205013
AA Change: L205R
SMART Domains Protein: ENSMUSP00000145482
Gene: ENSMUSG00000049052
AA Change: L205R

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 1.3e-44 PFAM
Pfam:7tm_1 39 288 4.1e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216182
AA Change: L205R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,293,071 K408E probably damaging Het
2010315B03Rik T A 9: 124,293,153 K380N probably damaging Het
9230104M06Rik C T 12: 113,000,739 probably benign Het
Ahi1 T A 10: 20,970,911 C413* probably null Het
Alms1 T A 6: 85,622,482 M1430K possibly damaging Het
Ankrd52 G T 10: 128,389,351 A894S probably benign Het
Arhgap33 C A 7: 30,527,229 V494L probably damaging Het
Atic G T 1: 71,568,971 V275F probably damaging Het
Atoh1 T A 6: 64,729,684 V121E probably damaging Het
Atp5h T A 11: 115,416,038 probably null Het
Baiap2l2 A T 15: 79,261,974 probably null Het
Brca2 A T 5: 150,541,762 T1664S probably benign Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Celf3 ACAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCA 3: 94,488,230 probably benign Het
Cep350 A T 1: 155,959,718 probably null Het
Ces2g T C 8: 104,965,989 probably null Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyp2d34 A G 15: 82,616,167 F457S probably damaging Het
Disp3 T A 4: 148,241,423 T1293S probably damaging Het
Dock10 T A 1: 80,540,253 I1348F possibly damaging Het
Dsp A T 13: 38,196,404 H1776L probably damaging Het
Efhd1 A T 1: 87,309,755 Q228L possibly damaging Het
Entpd2 T A 2: 25,399,283 I259N probably benign Het
Fam149b A T 14: 20,375,510 M138L probably damaging Het
Fastkd5 T C 2: 130,616,365 K102E probably benign Het
Fzd7 C A 1: 59,484,536 T526K possibly damaging Het
G6pd2 T A 5: 61,808,987 I35N probably damaging Het
Gars T A 6: 55,065,563 M427K probably damaging Het
Gimap4 C T 6: 48,690,865 R57C probably damaging Het
Gm11232 C A 4: 71,757,785 W41L probably benign Het
Gm15737 T A 6: 92,879,720 C43* probably null Het
Gm853 A T 4: 130,209,888 L420Q probably benign Het
Gpr180 T C 14: 118,139,773 V62A probably benign Het
H2-M11 C T 17: 36,548,150 T194I possibly damaging Het
Jakmip3 A T 7: 138,989,468 E27V possibly damaging Het
Kcnq3 T C 15: 66,031,427 T145A probably damaging Het
Krt8 A G 15: 101,998,024 M350T probably benign Het
Krtap4-9 T A 11: 99,785,666 probably benign Het
Lbr G T 1: 181,836,127 D109E probably damaging Het
Med23 A G 10: 24,888,575 H42R probably damaging Het
Mgat5 A T 1: 127,307,004 M77L probably benign Het
Mlf1 A T 3: 67,384,586 N28I possibly damaging Het
Mroh3 A C 1: 136,198,126 L343R probably damaging Het
Mrpl37 T A 4: 107,064,493 I180F possibly damaging Het
Mrps27 T A 13: 99,400,328 C116* probably null Het
Muc6 A G 7: 141,640,384 S1354P possibly damaging Het
Myh7 A T 14: 54,983,242 D1033E probably damaging Het
Myo16 A T 8: 10,594,820 E1717D probably benign Het
Myo1g T A 11: 6,512,539 probably null Het
Olfr610 A G 7: 103,506,160 M262T probably benign Het
Pan2 T C 10: 128,313,897 L576P probably damaging Het
Parp8 A G 13: 116,895,687 S278P possibly damaging Het
Pdk2 A G 11: 95,027,202 probably null Het
Phf1 T C 17: 26,937,088 S450P probably damaging Het
Pkd1l2 T C 8: 117,019,494 Y1919C probably damaging Het
Postn T A 3: 54,376,953 S614T probably damaging Het
Psmg1 A T 16: 95,982,195 Y213* probably null Het
Rab11b T A 17: 33,747,718 T203S probably benign Het
Rad54l2 T A 9: 106,703,626 T899S possibly damaging Het
Ramp2 TTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 11: 101,246,545 probably benign Het
Rapgef6 A G 11: 54,687,711 T1028A possibly damaging Het
Rbm6 A G 9: 107,791,998 S58P possibly damaging Het
Rreb1 G T 13: 37,929,792 A376S possibly damaging Het
Rsbn1l T A 5: 20,919,769 N345I probably benign Het
Sf3b2 A T 19: 5,275,090 S785T possibly damaging Het
Sh2b1 C T 7: 126,468,926 D519N probably damaging Het
Slitrk6 T C 14: 110,750,272 T668A probably benign Het
Stkld1 T A 2: 26,950,638 I444N probably damaging Het
Sucla2 A T 14: 73,552,804 probably benign Het
Tmem67 T A 4: 12,079,918 L190F probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trem2 G A 17: 48,351,835 W191* probably null Het
Ube2d4 A T 15: 58,846,679 noncoding transcript Het
Uimc1 G T 13: 55,075,804 D218E probably damaging Het
Wdr62 A T 7: 30,273,999 V95E probably damaging Het
Zfhx4 T C 3: 5,245,143 V862A probably damaging Het
Zfp462 T A 4: 55,008,522 S163T probably benign Het
Zfp704 T C 3: 9,609,493 D76G unknown Het
Other mutations in Olfr815
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Olfr815 APN 10 129902659 missense possibly damaging 0.94
IGL01901:Olfr815 APN 10 129901853 missense probably benign 0.19
IGL02687:Olfr815 APN 10 129902102 missense probably benign 0.00
IGL02932:Olfr815 APN 10 129902418 nonsense probably null
IGL03327:Olfr815 APN 10 129902582 missense possibly damaging 0.87
R0894:Olfr815 UTSW 10 129901882 missense probably damaging 0.97
R1299:Olfr815 UTSW 10 129902077 missense probably benign 0.32
R1544:Olfr815 UTSW 10 129902424 nonsense probably null
R1939:Olfr815 UTSW 10 129902101 missense probably damaging 0.96
R2379:Olfr815 UTSW 10 129901912 missense probably damaging 0.99
R2435:Olfr815 UTSW 10 129902304 missense possibly damaging 0.52
R2892:Olfr815 UTSW 10 129901940 missense possibly damaging 0.60
R2905:Olfr815 UTSW 10 129902400 missense possibly damaging 0.93
R4552:Olfr815 UTSW 10 129902123 missense probably benign 0.00
R6566:Olfr815 UTSW 10 129902078 missense probably benign 0.00
R6988:Olfr815 UTSW 10 129902409 missense probably damaging 0.98
Z1088:Olfr815 UTSW 10 129902683 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- ACAGCTATTCCTTTGCTCAAAGTC -3'
(R):5'- CATCAGCTTGTCCTGGGTTC -3'

Sequencing Primer
(F):5'- AAGTCACTCTTTCATTTGCTGAAGGC -3'
(R):5'- CTTGGGTAACTGGATTCCTGG -3'
Posted On2014-12-04