Incidental Mutation 'R2566:Rab11b'
ID254514
Institutional Source Beutler Lab
Gene Symbol Rab11b
Ensembl Gene ENSMUSG00000077450
Gene NameRAB11B, member RAS oncogene family
SynonymsA730055L17Rik
MMRRC Submission 040425-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2566 (G1)
Quality Score192
Status Not validated
Chromosome17
Chromosomal Location33742484-33760530 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33747718 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 203 (T203S)
Ref Sequence ENSEMBL: ENSMUSP00000110021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057373] [ENSMUST00000173860] [ENSMUST00000173987]
Predicted Effect probably benign
Transcript: ENSMUST00000057373
AA Change: T203S

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000110021
Gene: ENSMUSG00000077450
AA Change: T203S

DomainStartEndE-ValueType
RAB 12 175 3.76e-115 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000172894
SMART Domains Protein: ENSMUSP00000134544
Gene: ENSMUSG00000077450

DomainStartEndE-ValueType
RAB 2 118 3.53e-56 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173860
AA Change: T178S

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000134448
Gene: ENSMUSG00000077450
AA Change: T178S

DomainStartEndE-ValueType
RAB 12 150 3.17e-81 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173987
SMART Domains Protein: ENSMUSP00000133921
Gene: ENSMUSG00000077450

DomainStartEndE-ValueType
RAB 12 149 2.81e-82 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174744
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Ras superfamily of small GTP-binding proteins, which includes the Ras (see MIM 190020), Ral (see MIM 179550), Rho (see MIM 165390), Rap (see MIM 179520), and Rab (see MIM 179508) families, is involved in controlling a diverse set of essential cellular functions. The Rab family, including RAB11B, appears to play a critical role in regulating exocytotic and endocytotic pathways (summary by Zhu et al., 1994 [PubMed 7811277]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010315B03Rik T C 9: 124,293,071 K408E probably damaging Het
2010315B03Rik T A 9: 124,293,153 K380N probably damaging Het
9230104M06Rik C T 12: 113,000,739 probably benign Het
Ahi1 T A 10: 20,970,911 C413* probably null Het
Alms1 T A 6: 85,622,482 M1430K possibly damaging Het
Ankrd52 G T 10: 128,389,351 A894S probably benign Het
Arhgap33 C A 7: 30,527,229 V494L probably damaging Het
Atic G T 1: 71,568,971 V275F probably damaging Het
Atoh1 T A 6: 64,729,684 V121E probably damaging Het
Atp5h T A 11: 115,416,038 probably null Het
Baiap2l2 A T 15: 79,261,974 probably null Het
Brca2 A T 5: 150,541,762 T1664S probably benign Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Celf3 ACAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCA 3: 94,488,230 probably benign Het
Cep350 A T 1: 155,959,718 probably null Het
Ces2g T C 8: 104,965,989 probably null Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyp2d34 A G 15: 82,616,167 F457S probably damaging Het
Disp3 T A 4: 148,241,423 T1293S probably damaging Het
Dock10 T A 1: 80,540,253 I1348F possibly damaging Het
Dsp A T 13: 38,196,404 H1776L probably damaging Het
Efhd1 A T 1: 87,309,755 Q228L possibly damaging Het
Entpd2 T A 2: 25,399,283 I259N probably benign Het
Fam149b A T 14: 20,375,510 M138L probably damaging Het
Fastkd5 T C 2: 130,616,365 K102E probably benign Het
Fzd7 C A 1: 59,484,536 T526K possibly damaging Het
G6pd2 T A 5: 61,808,987 I35N probably damaging Het
Gars T A 6: 55,065,563 M427K probably damaging Het
Gimap4 C T 6: 48,690,865 R57C probably damaging Het
Gm11232 C A 4: 71,757,785 W41L probably benign Het
Gm15737 T A 6: 92,879,720 C43* probably null Het
Gm853 A T 4: 130,209,888 L420Q probably benign Het
Gpr180 T C 14: 118,139,773 V62A probably benign Het
H2-M11 C T 17: 36,548,150 T194I possibly damaging Het
Jakmip3 A T 7: 138,989,468 E27V possibly damaging Het
Kcnq3 T C 15: 66,031,427 T145A probably damaging Het
Krt8 A G 15: 101,998,024 M350T probably benign Het
Krtap4-9 T A 11: 99,785,666 probably benign Het
Lbr G T 1: 181,836,127 D109E probably damaging Het
Med23 A G 10: 24,888,575 H42R probably damaging Het
Mgat5 A T 1: 127,307,004 M77L probably benign Het
Mlf1 A T 3: 67,384,586 N28I possibly damaging Het
Mroh3 A C 1: 136,198,126 L343R probably damaging Het
Mrpl37 T A 4: 107,064,493 I180F possibly damaging Het
Mrps27 T A 13: 99,400,328 C116* probably null Het
Muc6 A G 7: 141,640,384 S1354P possibly damaging Het
Myh7 A T 14: 54,983,242 D1033E probably damaging Het
Myo16 A T 8: 10,594,820 E1717D probably benign Het
Myo1g T A 11: 6,512,539 probably null Het
Olfr610 A G 7: 103,506,160 M262T probably benign Het
Olfr815 A C 10: 129,902,095 L205R probably damaging Het
Pan2 T C 10: 128,313,897 L576P probably damaging Het
Parp8 A G 13: 116,895,687 S278P possibly damaging Het
Pdk2 A G 11: 95,027,202 probably null Het
Phf1 T C 17: 26,937,088 S450P probably damaging Het
Pkd1l2 T C 8: 117,019,494 Y1919C probably damaging Het
Postn T A 3: 54,376,953 S614T probably damaging Het
Psmg1 A T 16: 95,982,195 Y213* probably null Het
Rad54l2 T A 9: 106,703,626 T899S possibly damaging Het
Ramp2 TTGCTGCTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTGCTGCTG 11: 101,246,545 probably benign Het
Rapgef6 A G 11: 54,687,711 T1028A possibly damaging Het
Rbm6 A G 9: 107,791,998 S58P possibly damaging Het
Rreb1 G T 13: 37,929,792 A376S possibly damaging Het
Rsbn1l T A 5: 20,919,769 N345I probably benign Het
Sf3b2 A T 19: 5,275,090 S785T possibly damaging Het
Sh2b1 C T 7: 126,468,926 D519N probably damaging Het
Slitrk6 T C 14: 110,750,272 T668A probably benign Het
Stkld1 T A 2: 26,950,638 I444N probably damaging Het
Sucla2 A T 14: 73,552,804 probably benign Het
Tmem67 T A 4: 12,079,918 L190F probably damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trem2 G A 17: 48,351,835 W191* probably null Het
Ube2d4 A T 15: 58,846,679 noncoding transcript Het
Uimc1 G T 13: 55,075,804 D218E probably damaging Het
Wdr62 A T 7: 30,273,999 V95E probably damaging Het
Zfhx4 T C 3: 5,245,143 V862A probably damaging Het
Zfp462 T A 4: 55,008,522 S163T probably benign Het
Zfp704 T C 3: 9,609,493 D76G unknown Het
Other mutations in Rab11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02317:Rab11b APN 17 33749816 missense probably damaging 1.00
R1969:Rab11b UTSW 17 33760235 missense probably damaging 1.00
R2096:Rab11b UTSW 17 33749002 missense probably damaging 1.00
R3706:Rab11b UTSW 17 33747766 missense probably benign
R4093:Rab11b UTSW 17 33749789 missense possibly damaging 0.94
R5070:Rab11b UTSW 17 33748881 missense probably damaging 1.00
R5218:Rab11b UTSW 17 33748950 missense probably benign 0.03
R5306:Rab11b UTSW 17 33760269 utr 5 prime probably benign
R7205:Rab11b UTSW 17 33749867 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTCTTGAGCAGGCAGGAC -3'
(R):5'- TAGCCAATACCCTGCAGAAAGG -3'

Sequencing Primer
(F):5'- ATTTCTGAGTTCGAGGCCAGCC -3'
(R):5'- AGGTAAATTGCCTTCCCTAGGGTAC -3'
Posted On2014-12-04