Incidental Mutation 'R0317:Arfip2'
ID25455
Institutional Source Beutler Lab
Gene Symbol Arfip2
Ensembl Gene ENSMUSG00000030881
Gene NameADP-ribosylation factor interacting protein 2
Synonyms2310002N04Rik, Arfaptin 2
MMRRC Submission 038527-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0317 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location105634203-105640416 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 105637223 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 124 (T124M)
Ref Sequence ENSEMBL: ENSMUSP00000147995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033171] [ENSMUST00000057525] [ENSMUST00000058333] [ENSMUST00000084782] [ENSMUST00000106780] [ENSMUST00000106783] [ENSMUST00000106784] [ENSMUST00000106785] [ENSMUST00000106786] [ENSMUST00000106789] [ENSMUST00000106791] [ENSMUST00000131446] [ENSMUST00000133519] [ENSMUST00000137931] [ENSMUST00000140577] [ENSMUST00000142363] [ENSMUST00000142874] [ENSMUST00000147044] [ENSMUST00000149819] [ENSMUST00000150479] [ENSMUST00000151193] [ENSMUST00000153371] [ENSMUST00000157028] [ENSMUST00000209445] [ENSMUST00000209550] [ENSMUST00000209588] [ENSMUST00000210312] [ENSMUST00000210350] [ENSMUST00000210911] [ENSMUST00000211054]
Predicted Effect probably benign
Transcript: ENSMUST00000033171
SMART Domains Protein: ENSMUSP00000033171
Gene: ENSMUSG00000030881

DomainStartEndE-ValueType
low complexity region 52 61 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057525
SMART Domains Protein: ENSMUSP00000053384
Gene: ENSMUSG00000036989

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 151 7.54e-14 SMART
BBC 158 284 2.55e-42 SMART
IG_FLMN 321 421 1.06e-31 SMART
Pfam:NHL 486 513 2.5e-9 PFAM
Pfam:NHL 533 560 1.9e-9 PFAM
Pfam:NHL 575 602 5.5e-8 PFAM
Pfam:NHL 622 649 1e-10 PFAM
Pfam:NHL 669 696 1.8e-12 PFAM
Pfam:NHL 713 740 1.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000058333
SMART Domains Protein: ENSMUSP00000057061
Gene: ENSMUSG00000089847

DomainStartEndE-ValueType
Pfam:zf-Tim10_DDP 2 67 8.1e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000084782
AA Change: T198M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000081840
Gene: ENSMUSG00000030881
AA Change: T198M

DomainStartEndE-ValueType
low complexity region 52 61 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
Arfaptin 89 316 1.72e-123 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106780
SMART Domains Protein: ENSMUSP00000102392
Gene: ENSMUSG00000089847

DomainStartEndE-ValueType
Pfam:zf-Tim10_DDP 2 67 8.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106783
SMART Domains Protein: ENSMUSP00000102395
Gene: ENSMUSG00000089847

DomainStartEndE-ValueType
Pfam:zf-Tim10_DDP 2 67 8.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106784
Predicted Effect probably benign
Transcript: ENSMUST00000106785
SMART Domains Protein: ENSMUSP00000102397
Gene: ENSMUSG00000110234

DomainStartEndE-ValueType
Pfam:zf-Tim10_DDP 2 67 3.8e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106786
SMART Domains Protein: ENSMUSP00000102398
Gene: ENSMUSG00000110234

DomainStartEndE-ValueType
Pfam:zf-Tim10_DDP 3 66 3.6e-18 PFAM
low complexity region 89 107 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106789
SMART Domains Protein: ENSMUSP00000102401
Gene: ENSMUSG00000036989

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 151 7.54e-14 SMART
BBC 158 284 2.55e-42 SMART
IG_FLMN 321 421 1.06e-31 SMART
Pfam:NHL 486 513 1.8e-8 PFAM
Pfam:NHL 533 560 3.9e-10 PFAM
Pfam:NHL 575 602 2.3e-7 PFAM
Pfam:NHL 622 649 3.9e-10 PFAM
Pfam:NHL 669 696 2.2e-12 PFAM
Pfam:NHL 713 740 6.5e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106791
SMART Domains Protein: ENSMUSP00000102403
Gene: ENSMUSG00000036989

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 151 7.54e-14 SMART
BBC 158 284 2.55e-42 SMART
IG_FLMN 321 421 1.06e-31 SMART
Pfam:NHL 486 513 3.4e-8 PFAM
Pfam:NHL 533 560 7.6e-10 PFAM
Pfam:NHL 575 602 4.4e-7 PFAM
Pfam:NHL 622 649 7.6e-10 PFAM
Pfam:NHL 669 696 2.7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126589
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127759
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127853
Predicted Effect probably damaging
Transcript: ENSMUST00000131446
AA Change: T198M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120387
Gene: ENSMUSG00000030881
AA Change: T198M

DomainStartEndE-ValueType
low complexity region 52 61 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
Arfaptin 89 316 1.72e-123 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000133519
AA Change: T198M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121649
Gene: ENSMUSG00000030881
AA Change: T198M

DomainStartEndE-ValueType
low complexity region 52 61 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
Arfaptin 89 209 5.49e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134613
Predicted Effect possibly damaging
Transcript: ENSMUST00000137931
AA Change: R158C

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118616
Gene: ENSMUSG00000030881
AA Change: R158C

DomainStartEndE-ValueType
low complexity region 52 61 N/A INTRINSIC
low complexity region 65 81 N/A INTRINSIC
Pfam:Arfaptin 89 153 1.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140385
Predicted Effect probably benign
Transcript: ENSMUST00000140577
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142173
Predicted Effect probably benign
Transcript: ENSMUST00000142363
Predicted Effect probably benign
Transcript: ENSMUST00000142874
Predicted Effect probably benign
Transcript: ENSMUST00000147044
SMART Domains Protein: ENSMUSP00000114822
Gene: ENSMUSG00000036989

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149819
Predicted Effect probably benign
Transcript: ENSMUST00000150479
Predicted Effect probably benign
Transcript: ENSMUST00000151193
Predicted Effect probably benign
Transcript: ENSMUST00000153371
SMART Domains Protein: ENSMUSP00000119910
Gene: ENSMUSG00000036989

DomainStartEndE-ValueType
RING 22 62 6.43e-8 SMART
BBOX 110 157 3.55e-10 SMART
Blast:BBC 164 199 9e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000157028
Predicted Effect probably benign
Transcript: ENSMUST00000209445
Predicted Effect probably damaging
Transcript: ENSMUST00000209550
AA Change: T194M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000209588
Predicted Effect probably benign
Transcript: ENSMUST00000209870
Predicted Effect probably benign
Transcript: ENSMUST00000210312
Predicted Effect probably benign
Transcript: ENSMUST00000210350
Predicted Effect probably benign
Transcript: ENSMUST00000210893
Predicted Effect probably damaging
Transcript: ENSMUST00000210911
AA Change: T124M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000211054
Meta Mutation Damage Score 0.19 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,293,459 V1774A probably damaging Het
Adam34 G A 8: 43,652,251 P119L probably benign Het
Ap3b2 T C 7: 81,463,681 probably null Het
Arhgef26 T C 3: 62,423,544 S560P probably damaging Het
Bcl11a A T 11: 24,172,697 probably null Het
Cab39 A G 1: 85,849,160 E322G probably damaging Het
Cad C A 5: 31,072,321 P1382Q probably benign Het
Cc2d2a T C 5: 43,706,901 probably null Het
Cela2a A T 4: 141,821,700 probably null Het
Ces1e A C 8: 93,224,039 I38S probably benign Het
Ces1f A T 8: 93,263,391 F364I probably benign Het
Chgb A G 2: 132,793,811 T558A probably benign Het
Cnpy4 C T 5: 138,192,812 Q217* probably null Het
Col4a3bp C T 13: 96,634,121 R487* probably null Het
Crlf1 A G 8: 70,498,599 T43A probably benign Het
Dnah7b T A 1: 46,134,656 M707K probably damaging Het
Ets2 G A 16: 95,712,149 S123N probably damaging Het
Fam196b C A 11: 34,402,826 D289E possibly damaging Het
Fry T C 5: 150,471,468 F304S probably damaging Het
Gadd45gip1 G A 8: 84,834,116 R120H probably benign Het
Gbf1 A G 19: 46,254,020 T96A probably benign Het
Ggn T A 7: 29,171,090 M1K probably null Het
Gm5239 A G 18: 35,536,916 T112A probably benign Het
Kif1bp A T 10: 62,578,082 probably null Het
Lrrc15 A T 16: 30,273,743 H259Q probably benign Het
Lysmd4 A G 7: 67,226,297 Y236C probably damaging Het
Med29 T C 7: 28,386,859 T175A possibly damaging Het
Mfsd12 G T 10: 81,357,799 D68Y probably damaging Het
Myh1 T C 11: 67,217,512 L1308P probably damaging Het
Nphp4 T A 4: 152,551,931 probably null Het
Olfr948 A G 9: 39,319,461 I51T probably benign Het
Pdhx A G 2: 103,028,280 V393A probably benign Het
Pgm5 A G 19: 24,824,399 I155T possibly damaging Het
Pgr A T 9: 8,965,022 I889F probably benign Het
Phactr4 T A 4: 132,386,930 K51I probably damaging Het
Pum2 T A 12: 8,728,754 I468K possibly damaging Het
Rab11a A G 9: 64,725,553 S24P probably damaging Het
Rasef T C 4: 73,748,562 Q160R probably damaging Het
Rbl2 A G 8: 91,087,144 D339G probably benign Het
Recql5 A G 11: 115,894,673 S666P probably benign Het
Rfc1 A T 5: 65,296,052 probably null Het
Scarb1 A G 5: 125,289,692 V59A probably damaging Het
Slc2a4 C T 11: 69,946,356 V85M probably damaging Het
Slc6a12 A G 6: 121,358,625 I291V possibly damaging Het
Slco3a1 A C 7: 74,504,426 Y104D probably damaging Het
Suz12 T A 11: 79,999,078 D13E probably damaging Het
Tlr1 G T 5: 64,925,967 C422* probably null Het
Tmco1 T C 1: 167,325,893 V114A probably damaging Het
Trpa1 T C 1: 14,881,632 T948A probably benign Het
Tub A T 7: 109,020,927 N93Y probably damaging Het
Ufsp2 G A 8: 45,992,233 probably null Het
Veph1 T C 3: 66,171,975 D373G probably benign Het
Vmn1r206 A G 13: 22,620,960 S26P possibly damaging Het
Vmn2r1 T C 3: 64,081,819 S60P possibly damaging Het
Wdcp A G 12: 4,851,583 S480G probably benign Het
Wnk4 T C 11: 101,268,804 S612P probably benign Het
Zfp503 T C 14: 21,986,459 K130E probably benign Het
Zkscan16 G A 4: 58,957,602 C628Y possibly damaging Het
Other mutations in Arfip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02105:Arfip2 APN 7 105639383 missense probably damaging 1.00
IGL03192:Arfip2 APN 7 105637943 missense probably damaging 1.00
IGL03299:Arfip2 APN 7 105637943 missense probably damaging 1.00
R0096:Arfip2 UTSW 7 105638230 missense probably damaging 1.00
R0121:Arfip2 UTSW 7 105636371 missense probably damaging 1.00
R0130:Arfip2 UTSW 7 105638998 unclassified probably benign
R0152:Arfip2 UTSW 7 105637223 missense probably damaging 1.00
R2172:Arfip2 UTSW 7 105637988 missense probably damaging 1.00
R4419:Arfip2 UTSW 7 105639063 missense probably damaging 1.00
R4926:Arfip2 UTSW 7 105637944 missense probably damaging 1.00
R5394:Arfip2 UTSW 7 105636976 nonsense probably null
R5637:Arfip2 UTSW 7 105637163 missense probably damaging 1.00
Z1088:Arfip2 UTSW 7 105637242 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCATCATATTCCAGCCTGGGAAG -3'
(R):5'- TGTGGCTAAGAGAGCCTTGCTAGAG -3'

Sequencing Primer
(F):5'- CTTTCCTTTCTGAATCTGTATGCC -3'
(R):5'- AGCCTTGCTAGAGGCAGTC -3'
Posted On2013-04-16