Incidental Mutation 'R2568:Marco'
ID254598
Institutional Source Beutler Lab
Gene Symbol Marco
Ensembl Gene ENSMUSG00000026390
Gene Namemacrophage receptor with collagenous structure
SynonymsScara2
MMRRC Submission 040427-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.233) question?
Stock #R2568 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location120474538-120505024 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 120494785 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 49 (H49R)
Ref Sequence ENSEMBL: ENSMUSP00000140948 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027639] [ENSMUST00000186432]
Predicted Effect probably benign
Transcript: ENSMUST00000027639
AA Change: H56R

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000027639
Gene: ENSMUSG00000026390
AA Change: H56R

DomainStartEndE-ValueType
SCOP:d1g38a_ 65 93 1e-2 SMART
low complexity region 112 122 N/A INTRINSIC
Pfam:Collagen 149 208 2.5e-12 PFAM
Pfam:Collagen 192 266 2.7e-10 PFAM
low complexity region 293 315 N/A INTRINSIC
low complexity region 323 345 N/A INTRINSIC
internal_repeat_1 347 400 5.11e-17 PROSPERO
low complexity region 401 419 N/A INTRINSIC
SR 423 518 1.66e-48 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000186432
AA Change: H49R

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140948
Gene: ENSMUSG00000026390
AA Change: H49R

DomainStartEndE-ValueType
transmembrane domain 40 62 N/A INTRINSIC
Pfam:Collagen 68 123 3.7e-10 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the class A scavenger receptor family and is part of the innate antimicrobial immune system. The protein may bind both Gram-negative and Gram-positive bacteria via an extracellular, C-terminal, scavenger receptor cysteine-rich (SRCR) domain. In addition to short cytoplasmic and transmembrane domains, there is an extracellular spacer domain and a long, extracellular collagenous domain. The protein may form a trimeric molecule by the association of the collagenous domains of three identical polypeptide chains. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele show altered spleen marginal zone architecture and impaired IgM responses to a pneumococcal polysaccharide vaccine. Mice homozygous for another null allele show increased susceptibility to bacterial pneumonia and enhanced inflammatory responses to inhaled particles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,201,269 V1010A possibly damaging Het
4930563D23Rik A G 16: 92,321,319 L27P probably damaging Het
A730071L15Rik A T 11: 6,200,161 probably benign Het
Abca13 A T 11: 9,333,310 N3244I probably benign Het
Adgrf5 A G 17: 43,437,671 T219A probably damaging Het
Adgrg5 A T 8: 94,934,021 N92I probably damaging Het
Agt A C 8: 124,556,955 V475G probably damaging Het
Akap6 A G 12: 52,887,278 K518E possibly damaging Het
Apoh T G 11: 108,404,871 D133E probably benign Het
Axdnd1 T A 1: 156,392,749 M234L possibly damaging Het
Cacna1d A G 14: 30,082,511 I1335T probably damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cfap206 T A 4: 34,711,566 K444* probably null Het
Clasp2 A G 9: 113,878,764 I614M probably benign Het
Col6a4 A T 9: 106,063,076 D1218E possibly damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
D130043K22Rik C T 13: 24,883,891 T870M probably damaging Het
Dagla C A 19: 10,248,152 A883S probably benign Het
Dhx30 A G 9: 110,097,195 V87A probably damaging Het
Dtx1 C A 5: 120,710,184 V44L possibly damaging Het
Ecm2 T A 13: 49,530,129 S528T possibly damaging Het
Egfem1 A T 3: 29,582,931 N172I probably damaging Het
Fam102b T A 3: 108,978,848 N356I probably benign Het
Fam13a T G 6: 58,935,609 R686S probably damaging Het
Fmo1 T A 1: 162,836,259 I234L probably benign Het
Foxj2 C T 6: 122,828,372 R68W probably damaging Het
Foxo6 A T 4: 120,268,764 M278K probably benign Het
Fsip2 A G 2: 82,990,431 S5503G probably benign Het
Gdf5 C G 2: 155,942,090 R100G probably benign Het
Il1b A T 2: 129,367,322 D129E probably damaging Het
Klhl29 A G 12: 5,091,350 S545P probably damaging Het
Krt83 G T 15: 101,487,827 R296S possibly damaging Het
Llgl1 T G 11: 60,708,812 S509R probably damaging Het
Lmod1 A T 1: 135,363,964 K186* probably null Het
Lrpprc C T 17: 84,726,649 A973T probably damaging Het
Mylk4 T C 13: 32,722,018 N394S probably null Het
Myo5a A G 9: 75,123,040 Y147C probably damaging Het
Myo5a T C 9: 75,151,897 V469A probably damaging Het
Myot A G 18: 44,337,216 T87A probably benign Het
Nav2 A G 7: 49,597,564 H2154R probably damaging Het
Nek10 A G 14: 14,999,112 E1037G possibly damaging Het
Olfr181 A G 16: 58,925,923 V216A probably benign Het
Olfr341 T C 2: 36,479,974 D52G probably damaging Het
Olfr677 A G 7: 105,056,671 T142A probably benign Het
Pitrm1 G T 13: 6,575,092 V869F probably benign Het
Plekhm3 CCTGCTGCTGCTGCTGCTGCTGCTGC CCTGCTGCTGCTGCTGCTGCTGC 1: 64,937,781 probably benign Het
Prdx1 T G 4: 116,693,800 I156S probably benign Het
Rbks T A 5: 31,665,752 T107S probably damaging Het
Ryr3 G A 2: 112,675,874 R3468W probably damaging Het
Scn1a C T 2: 66,273,469 D1805N probably damaging Het
Sirpa T C 2: 129,615,648 V214A probably benign Het
Slc35c1 T C 2: 92,458,880 N94D probably benign Het
Sorbs2 A T 8: 45,795,370 K553* probably null Het
Tectb C G 19: 55,180,999 probably benign Het
Thg1l A G 11: 45,951,565 V142A probably benign Het
Tiparp T A 3: 65,553,130 Y513* probably null Het
Tmc6 A G 11: 117,772,820 V522A probably benign Het
Trim39 T A 17: 36,269,164 probably benign Het
Trrap G A 5: 144,843,369 probably null Het
Tulp3 C T 6: 128,327,638 V218I probably benign Het
Vmn1r38 T A 6: 66,776,971 I54F probably benign Het
Vmn2r23 T A 6: 123,742,188 Y833* probably null Het
Zfp810 A T 9: 22,279,238 S125T probably benign Het
Other mutations in Marco
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Marco APN 1 120485703 missense probably benign
IGL01343:Marco APN 1 120494740 critical splice donor site probably null
IGL02117:Marco APN 1 120490954 missense probably benign 0.00
IGL02338:Marco APN 1 120494779 missense possibly damaging 0.90
IGL03293:Marco APN 1 120494795 missense probably benign 0.08
P0027:Marco UTSW 1 120474712 missense probably damaging 1.00
R0548:Marco UTSW 1 120492038 missense probably benign 0.00
R1450:Marco UTSW 1 120476745 splice site probably benign
R1958:Marco UTSW 1 120484864 missense probably damaging 1.00
R2444:Marco UTSW 1 120494770 missense probably damaging 1.00
R4740:Marco UTSW 1 120494770 missense probably damaging 1.00
R4979:Marco UTSW 1 120494225 missense probably benign 0.02
R5393:Marco UTSW 1 120485854 missense probably damaging 1.00
R5536:Marco UTSW 1 120504735 missense possibly damaging 0.85
R6022:Marco UTSW 1 120488565 missense probably benign 0.00
R6028:Marco UTSW 1 120490942 missense probably damaging 0.97
R6058:Marco UTSW 1 120476706 missense probably damaging 1.00
T0722:Marco UTSW 1 120474712 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGTCTAACCAGTGTGTCCTAG -3'
(R):5'- CTAAACATGGAACTTCTTGCCTTGTG -3'

Sequencing Primer
(F):5'- GCACAGGGCAGCAGAACTC -3'
(R):5'- ACAAGAAAGATCTGGTTGCCTTTCC -3'
Posted On2014-12-04