Incidental Mutation 'R0317:Pgr'
ID25464
Institutional Source Beutler Lab
Gene Symbol Pgr
Ensembl Gene ENSMUSG00000031870
Gene Nameprogesterone receptor
Synonyms9930019P03Rik, ENSMUSG00000074510, PR-A, PR-B, PR, NR3C3
MMRRC Submission 038527-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.426) question?
Stock #R0317 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location8899833-8968611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 8965022 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 889 (I889F)
Ref Sequence ENSEMBL: ENSMUSP00000140124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070463] [ENSMUST00000098986] [ENSMUST00000189181]
Predicted Effect probably benign
Transcript: ENSMUST00000070463
AA Change: I889F

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000063562
Gene: ENSMUSG00000031870
AA Change: I889F

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
low complexity region 108 120 N/A INTRINSIC
low complexity region 244 265 N/A INTRINSIC
low complexity region 337 354 N/A INTRINSIC
low complexity region 418 431 N/A INTRINSIC
low complexity region 434 454 N/A INTRINSIC
low complexity region 493 503 N/A INTRINSIC
low complexity region 505 519 N/A INTRINSIC
ZnF_C4 557 628 1.29e-29 SMART
low complexity region 703 711 N/A INTRINSIC
HOLI 713 877 3.21e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098986
AA Change: I724F

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000096584
Gene: ENSMUSG00000031870
AA Change: I724F

DomainStartEndE-ValueType
low complexity region 79 100 N/A INTRINSIC
low complexity region 172 189 N/A INTRINSIC
low complexity region 253 266 N/A INTRINSIC
low complexity region 269 289 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
low complexity region 340 354 N/A INTRINSIC
ZnF_C4 392 463 1.29e-29 SMART
low complexity region 538 546 N/A INTRINSIC
HOLI 548 712 3.21e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189181
AA Change: I889F

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000140124
Gene: ENSMUSG00000031870
AA Change: I889F

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
low complexity region 108 120 N/A INTRINSIC
low complexity region 244 265 N/A INTRINSIC
low complexity region 337 354 N/A INTRINSIC
low complexity region 418 431 N/A INTRINSIC
low complexity region 434 454 N/A INTRINSIC
low complexity region 493 503 N/A INTRINSIC
low complexity region 505 519 N/A INTRINSIC
ZnF_C4 557 628 1.29e-29 SMART
low complexity region 703 711 N/A INTRINSIC
HOLI 713 877 3.21e-34 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the steroid receptor superfamily. The encoded protein mediates the physiological effects of progesterone, which plays a central role in reproductive events associated with the establishment and maintenance of pregnancy. [provided by RefSeq, Sep 2015]
PHENOTYPE: Null female mice are sterile and exhibit ovulatory defects, uterine hyperplasia, and impaired mammary development. Females lacking only isoform A are infertile but show normal mammary development, while females lacking only isoform B are fertile but present with mammary developmental defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,293,459 V1774A probably damaging Het
Adam34 G A 8: 43,652,251 P119L probably benign Het
Ap3b2 T C 7: 81,463,681 probably null Het
Arfip2 G A 7: 105,637,223 T124M probably damaging Het
Arhgef26 T C 3: 62,423,544 S560P probably damaging Het
Bcl11a A T 11: 24,172,697 probably null Het
Cab39 A G 1: 85,849,160 E322G probably damaging Het
Cad C A 5: 31,072,321 P1382Q probably benign Het
Cc2d2a T C 5: 43,706,901 probably null Het
Cela2a A T 4: 141,821,700 probably null Het
Ces1e A C 8: 93,224,039 I38S probably benign Het
Ces1f A T 8: 93,263,391 F364I probably benign Het
Chgb A G 2: 132,793,811 T558A probably benign Het
Cnpy4 C T 5: 138,192,812 Q217* probably null Het
Col4a3bp C T 13: 96,634,121 R487* probably null Het
Crlf1 A G 8: 70,498,599 T43A probably benign Het
Dnah7b T A 1: 46,134,656 M707K probably damaging Het
Ets2 G A 16: 95,712,149 S123N probably damaging Het
Fam196b C A 11: 34,402,826 D289E possibly damaging Het
Fry T C 5: 150,471,468 F304S probably damaging Het
Gadd45gip1 G A 8: 84,834,116 R120H probably benign Het
Gbf1 A G 19: 46,254,020 T96A probably benign Het
Ggn T A 7: 29,171,090 M1K probably null Het
Gm5239 A G 18: 35,536,916 T112A probably benign Het
Kif1bp A T 10: 62,578,082 probably null Het
Lrrc15 A T 16: 30,273,743 H259Q probably benign Het
Lysmd4 A G 7: 67,226,297 Y236C probably damaging Het
Med29 T C 7: 28,386,859 T175A possibly damaging Het
Mfsd12 G T 10: 81,357,799 D68Y probably damaging Het
Myh1 T C 11: 67,217,512 L1308P probably damaging Het
Nphp4 T A 4: 152,551,931 probably null Het
Olfr948 A G 9: 39,319,461 I51T probably benign Het
Pdhx A G 2: 103,028,280 V393A probably benign Het
Pgm5 A G 19: 24,824,399 I155T possibly damaging Het
Phactr4 T A 4: 132,386,930 K51I probably damaging Het
Pum2 T A 12: 8,728,754 I468K possibly damaging Het
Rab11a A G 9: 64,725,553 S24P probably damaging Het
Rasef T C 4: 73,748,562 Q160R probably damaging Het
Rbl2 A G 8: 91,087,144 D339G probably benign Het
Recql5 A G 11: 115,894,673 S666P probably benign Het
Rfc1 A T 5: 65,296,052 probably null Het
Scarb1 A G 5: 125,289,692 V59A probably damaging Het
Slc2a4 C T 11: 69,946,356 V85M probably damaging Het
Slc6a12 A G 6: 121,358,625 I291V possibly damaging Het
Slco3a1 A C 7: 74,504,426 Y104D probably damaging Het
Suz12 T A 11: 79,999,078 D13E probably damaging Het
Tlr1 G T 5: 64,925,967 C422* probably null Het
Tmco1 T C 1: 167,325,893 V114A probably damaging Het
Trpa1 T C 1: 14,881,632 T948A probably benign Het
Tub A T 7: 109,020,927 N93Y probably damaging Het
Ufsp2 G A 8: 45,992,233 probably null Het
Veph1 T C 3: 66,171,975 D373G probably benign Het
Vmn1r206 A G 13: 22,620,960 S26P possibly damaging Het
Vmn2r1 T C 3: 64,081,819 S60P possibly damaging Het
Wdcp A G 12: 4,851,583 S480G probably benign Het
Wnk4 T C 11: 101,268,804 S612P probably benign Het
Zfp503 T C 14: 21,986,459 K130E probably benign Het
Zkscan16 G A 4: 58,957,602 C628Y possibly damaging Het
Other mutations in Pgr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01610:Pgr APN 9 8903691 missense possibly damaging 0.71
IGL01772:Pgr APN 9 8946636 splice site probably benign
IGL01963:Pgr APN 9 8922668 missense probably damaging 0.97
IGL02033:Pgr APN 9 8965110 missense probably damaging 1.00
IGL02837:Pgr APN 9 8946638 splice site probably benign
IGL03070:Pgr APN 9 8903664 missense possibly damaging 0.86
IGL03300:Pgr APN 9 8961539 missense probably damaging 1.00
R0152:Pgr UTSW 9 8965022 missense probably benign 0.45
R0305:Pgr UTSW 9 8902087 splice site probably benign
R0467:Pgr UTSW 9 8900778 missense possibly damaging 0.92
R1673:Pgr UTSW 9 8902068 missense possibly damaging 0.71
R1711:Pgr UTSW 9 8922714 splice site probably null
R1928:Pgr UTSW 9 8903629 nonsense probably null
R1951:Pgr UTSW 9 8946953 splice site probably benign
R2023:Pgr UTSW 9 8958398 missense probably damaging 0.99
R2426:Pgr UTSW 9 8900717 missense probably damaging 0.98
R2967:Pgr UTSW 9 8901818 missense possibly damaging 0.86
R3105:Pgr UTSW 9 8958396 missense probably benign 0.02
R3440:Pgr UTSW 9 8922629 missense probably damaging 0.98
R3735:Pgr UTSW 9 8901533 missense probably damaging 0.99
R3947:Pgr UTSW 9 8961452 missense probably benign 0.25
R4398:Pgr UTSW 9 8903749 critical splice donor site probably null
R4497:Pgr UTSW 9 8958419 missense probably damaging 0.99
R4811:Pgr UTSW 9 8900843 nonsense probably null
R4907:Pgr UTSW 9 8947043 intron probably benign
R4996:Pgr UTSW 9 8900913 missense probably damaging 0.99
R5448:Pgr UTSW 9 8922637 missense probably benign 0.06
R5449:Pgr UTSW 9 8956343 missense possibly damaging 0.95
R5699:Pgr UTSW 9 8900599 start gained probably benign
R5764:Pgr UTSW 9 8900537 missense probably benign 0.00
R6057:Pgr UTSW 9 8902005 missense probably damaging 0.98
R6134:Pgr UTSW 9 8900739 missense possibly damaging 0.51
R6242:Pgr UTSW 9 8900979 missense probably benign
R6476:Pgr UTSW 9 8964838 intron probably null
R6508:Pgr UTSW 9 8956289 missense probably damaging 1.00
R6604:Pgr UTSW 9 8946866 missense possibly damaging 0.73
R6715:Pgr UTSW 9 8964999 missense possibly damaging 0.93
R7444:Pgr UTSW 9 8946882 missense probably damaging 1.00
X0066:Pgr UTSW 9 8900834 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- AACCATTTCCACATTACCCTGGAGC -3'
(R):5'- CACATGACCTGACCATCCTGACTG -3'

Sequencing Primer
(F):5'- CACATTACCCTGGAGCATGGAG -3'
(R):5'- TGACCATCCTGACTGAGAAAAAG -3'
Posted On2013-04-16