Incidental Mutation 'R1450:Bag6'
ID254669
Institutional Source Beutler Lab
Gene Symbol Bag6
Ensembl Gene ENSMUSG00000024392
Gene NameBCL2-associated athanogene 6
SynonymsScythe, G3, D17H6S52E, Bat3, 2410045D21Rik
MMRRC Submission 039505-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1450 (G1)
Quality Score79
Status Validated
Chromosome17
Chromosomal Location35135178-35147322 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 35141958 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 422 (D422E)
Ref Sequence ENSEMBL: ENSMUSP00000025250 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025250] [ENSMUST00000166426] [ENSMUST00000172571] [ENSMUST00000173491] [ENSMUST00000173535] [ENSMUST00000173550] [ENSMUST00000173952] [ENSMUST00000174281] [ENSMUST00000174478]
Predicted Effect probably benign
Transcript: ENSMUST00000025250
AA Change: D422E

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000025250
Gene: ENSMUSG00000024392
AA Change: D422E

DomainStartEndE-ValueType
UBQ 17 87 5.62e-22 SMART
low complexity region 96 112 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
low complexity region 220 239 N/A INTRINSIC
low complexity region 246 264 N/A INTRINSIC
Pfam:DUF3538 277 393 1.7e-44 PFAM
low complexity region 427 438 N/A INTRINSIC
low complexity region 557 625 N/A INTRINSIC
low complexity region 632 648 N/A INTRINSIC
low complexity region 673 721 N/A INTRINSIC
low complexity region 725 747 N/A INTRINSIC
low complexity region 765 780 N/A INTRINSIC
low complexity region 798 808 N/A INTRINSIC
low complexity region 1029 1042 N/A INTRINSIC
low complexity region 1088 1098 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000166426
AA Change: D404E
SMART Domains Protein: ENSMUSP00000129324
Gene: ENSMUSG00000024392
AA Change: D404E

DomainStartEndE-ValueType
UBQ 17 87 5.62e-22 SMART
low complexity region 96 112 N/A INTRINSIC
low complexity region 171 188 N/A INTRINSIC
low complexity region 202 221 N/A INTRINSIC
low complexity region 228 246 N/A INTRINSIC
Pfam:DUF3538 259 375 3.7e-53 PFAM
low complexity region 409 420 N/A INTRINSIC
low complexity region 539 607 N/A INTRINSIC
low complexity region 614 630 N/A INTRINSIC
low complexity region 655 703 N/A INTRINSIC
low complexity region 707 729 N/A INTRINSIC
low complexity region 747 762 N/A INTRINSIC
low complexity region 780 790 N/A INTRINSIC
low complexity region 1011 1024 N/A INTRINSIC
low complexity region 1070 1080 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000172571
AA Change: D399E
SMART Domains Protein: ENSMUSP00000134175
Gene: ENSMUSG00000024392
AA Change: D399E

DomainStartEndE-ValueType
UBQ 17 87 5.62e-22 SMART
low complexity region 96 112 N/A INTRINSIC
low complexity region 171 188 N/A INTRINSIC
low complexity region 202 221 N/A INTRINSIC
low complexity region 228 252 N/A INTRINSIC
Pfam:DUF3538 254 370 3.5e-53 PFAM
low complexity region 404 415 N/A INTRINSIC
low complexity region 534 602 N/A INTRINSIC
low complexity region 609 625 N/A INTRINSIC
low complexity region 650 698 N/A INTRINSIC
low complexity region 702 724 N/A INTRINSIC
low complexity region 742 757 N/A INTRINSIC
low complexity region 775 785 N/A INTRINSIC
low complexity region 1006 1019 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172889
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172925
Predicted Effect probably benign
Transcript: ENSMUST00000172993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173351
Predicted Effect probably benign
Transcript: ENSMUST00000173491
SMART Domains Protein: ENSMUSP00000134279
Gene: ENSMUSG00000024392

DomainStartEndE-ValueType
UBQ 17 87 5.62e-22 SMART
low complexity region 96 112 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173535
AA Change: D463E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133822
Gene: ENSMUSG00000024392
AA Change: D463E

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 20 29 N/A INTRINSIC
low complexity region 30 45 N/A INTRINSIC
UBQ 58 128 5.62e-22 SMART
low complexity region 137 153 N/A INTRINSIC
low complexity region 230 247 N/A INTRINSIC
low complexity region 261 280 N/A INTRINSIC
low complexity region 287 305 N/A INTRINSIC
Pfam:DUF3538 318 434 1.3e-53 PFAM
low complexity region 468 479 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173550
AA Change: D404E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000134628
Gene: ENSMUSG00000024392
AA Change: D404E

DomainStartEndE-ValueType
UBQ 17 87 5.62e-22 SMART
low complexity region 96 112 N/A INTRINSIC
low complexity region 171 188 N/A INTRINSIC
low complexity region 202 221 N/A INTRINSIC
low complexity region 228 246 N/A INTRINSIC
Pfam:DUF3538 259 375 3.7e-53 PFAM
low complexity region 409 420 N/A INTRINSIC
low complexity region 496 511 N/A INTRINSIC
low complexity region 574 642 N/A INTRINSIC
low complexity region 649 665 N/A INTRINSIC
low complexity region 690 738 N/A INTRINSIC
low complexity region 742 764 N/A INTRINSIC
low complexity region 782 797 N/A INTRINSIC
low complexity region 815 825 N/A INTRINSIC
low complexity region 1046 1059 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173952
SMART Domains Protein: ENSMUSP00000134717
Gene: ENSMUSG00000024392

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 20 29 N/A INTRINSIC
low complexity region 30 45 N/A INTRINSIC
UBQ 58 128 5.62e-22 SMART
low complexity region 137 153 N/A INTRINSIC
low complexity region 212 229 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174281
AA Change: D422E

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000134425
Gene: ENSMUSG00000024392
AA Change: D422E

DomainStartEndE-ValueType
UBQ 17 87 5.62e-22 SMART
low complexity region 96 112 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
low complexity region 220 239 N/A INTRINSIC
low complexity region 246 264 N/A INTRINSIC
Pfam:DUF3538 277 393 3.6e-53 PFAM
low complexity region 427 438 N/A INTRINSIC
low complexity region 514 529 N/A INTRINSIC
low complexity region 592 660 N/A INTRINSIC
low complexity region 667 683 N/A INTRINSIC
low complexity region 708 756 N/A INTRINSIC
low complexity region 760 782 N/A INTRINSIC
low complexity region 800 815 N/A INTRINSIC
low complexity region 833 843 N/A INTRINSIC
low complexity region 1064 1077 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174478
SMART Domains Protein: ENSMUSP00000138117
Gene: ENSMUSG00000024392

DomainStartEndE-ValueType
UBQ 17 87 5.62e-22 SMART
low complexity region 96 112 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174797
Meta Mutation Damage Score 0.1144 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.0%
  • 20x: 84.8%
Validation Efficiency 96% (73/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was first characterized as part of a cluster of genes located within the human major histocompatibility complex class III region. This gene encodes a nuclear protein that is cleaved by caspase 3 and is implicated in the control of apoptosis. In addition, the protein forms a complex with E1A binding protein p300 and is required for the acetylation of p53 in response to DNA damage. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in either embryonic lethality following abnormal brain development or neonatal death associated with severe developmental defects in the lung and kidney. These developmental defects are associated with widespread aberrant apoptosis and proliferation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013F07Rik T A 3: 108,542,483 probably null Het
Abca13 A T 11: 9,430,531 probably benign Het
Adh4 C T 3: 138,424,174 P254S probably damaging Het
Amfr T C 8: 93,987,747 T223A probably benign Het
Ank2 T C 3: 126,957,302 T412A possibly damaging Het
Ccdc185 T G 1: 182,747,564 Q520P possibly damaging Het
Clock G A 5: 76,262,731 Q98* probably null Het
Cngb3 A T 4: 19,395,922 probably benign Het
Csmd1 T G 8: 15,945,180 probably null Het
Cubn A G 2: 13,360,319 L1636P probably damaging Het
Dennd4a A G 9: 64,911,665 I1701V probably benign Het
Dgcr2 T C 16: 17,856,814 H243R possibly damaging Het
Dimt1 A G 13: 106,947,643 N46S probably benign Het
Dnah9 T C 11: 65,927,786 Y58C probably damaging Het
Dsg1b T A 18: 20,409,184 V916E probably damaging Het
Dst T C 1: 34,188,395 S1690P probably damaging Het
Dst T A 1: 34,212,259 I2131K probably damaging Het
Epb41l1 T C 2: 156,511,825 probably benign Het
Fem1a T C 17: 56,257,579 V224A probably damaging Het
Got2 C T 8: 95,871,986 E203K probably benign Het
Hcar2 A T 5: 123,864,750 I230N probably damaging Het
Herc3 A T 6: 58,876,515 K554* probably null Het
Hfm1 A G 5: 106,918,458 F35L probably damaging Het
Hmcn1 A G 1: 150,652,506 probably benign Het
Hoxa13 C G 6: 52,260,647 probably benign Het
Hoxa13 G C 6: 52,260,648 probably benign Het
Hs2st1 C T 3: 144,434,718 probably benign Het
Igfbp5 T A 1: 72,873,889 D84V probably benign Het
Ints3 C A 3: 90,432,828 L41F probably damaging Het
Ipo5 T C 14: 120,944,393 V966A probably benign Het
Kif26a C T 12: 112,173,852 T505M probably damaging Het
Kpna2 A G 11: 106,997,309 S2P probably benign Het
Lct A G 1: 128,307,903 S456P probably damaging Het
Lonrf2 G A 1: 38,813,276 P165S probably benign Het
Lrrc7 T G 3: 158,187,044 I323L possibly damaging Het
Ly6g A G 15: 75,158,633 K77R probably benign Het
Maea T C 5: 33,365,800 probably null Het
Marco A T 1: 120,476,745 probably benign Het
Mcmbp G T 7: 128,715,931 probably benign Het
Mtr T A 13: 12,193,733 R1017W probably damaging Het
Myo15 T A 11: 60,495,482 I1811N probably damaging Het
Nbeal2 G A 9: 110,633,672 probably benign Het
Nlrp10 A G 7: 108,925,388 V295A probably damaging Het
Olfr1328 T C 4: 118,934,510 T111A probably benign Het
Olfr513 A T 7: 108,755,512 I219F probably damaging Het
Olfr616 A G 7: 103,564,451 V276A probably benign Het
Pde4b A T 4: 102,601,635 Q496L probably damaging Het
Peg12 C A 7: 62,463,576 G258* probably null Het
Pigc A G 1: 161,971,253 Y268C probably benign Het
Pnisr G T 4: 21,874,912 probably null Het
Poteg T C 8: 27,447,843 F5S probably benign Het
Prss40 T A 1: 34,556,097 I101F probably benign Het
Ptges3l T A 11: 101,421,905 D113V possibly damaging Het
Raver2 T C 4: 101,136,152 S510P possibly damaging Het
Rgr A T 14: 37,044,684 C94* probably null Het
Rp1l1 T A 14: 64,028,150 I395N probably benign Het
Sesn3 T A 9: 14,316,224 H168Q possibly damaging Het
Soga3 A T 10: 29,147,740 N361I probably damaging Het
Sox30 C A 11: 46,017,271 P755Q probably damaging Het
Stac3 T C 10: 127,504,885 F173S probably damaging Het
Synj2 C A 17: 6,027,324 probably benign Het
Tarsl2 A T 7: 65,647,496 I120L probably benign Het
Tas2r124 A G 6: 132,755,056 I109M probably damaging Het
Tm4sf19 A T 16: 32,407,963 H190L probably damaging Het
Tmem143 T G 7: 45,907,108 V179G probably damaging Het
Ubr4 T C 4: 139,468,028 F1187S probably damaging Het
Ubtfl1 A G 9: 18,409,913 R246G possibly damaging Het
Zdhhc5 A G 2: 84,702,389 F57S probably damaging Het
Zfp40 A T 17: 23,175,258 M717K probably benign Het
Other mutations in Bag6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Bag6 APN 17 35144651 missense probably damaging 1.00
IGL00489:Bag6 APN 17 35144651 missense probably damaging 1.00
IGL01613:Bag6 APN 17 35143016 unclassified probably benign
IGL01735:Bag6 APN 17 35145761 unclassified probably benign
IGL02146:Bag6 APN 17 35136215 missense probably damaging 1.00
IGL03092:Bag6 APN 17 35145627 missense probably damaging 1.00
IGL03377:Bag6 APN 17 35144982 missense probably damaging 1.00
R0196:Bag6 UTSW 17 35144263 missense probably damaging 1.00
R0449:Bag6 UTSW 17 35141466 missense probably damaging 1.00
R1228:Bag6 UTSW 17 35145333 missense probably damaging 0.99
R1686:Bag6 UTSW 17 35144952 missense possibly damaging 0.84
R1869:Bag6 UTSW 17 35142826 missense probably benign 0.05
R2034:Bag6 UTSW 17 35144692 missense probably damaging 0.99
R2205:Bag6 UTSW 17 35144607 missense probably damaging 1.00
R2428:Bag6 UTSW 17 35147175 missense probably damaging 1.00
R2987:Bag6 UTSW 17 35145685 nonsense probably null
R4691:Bag6 UTSW 17 35139248 missense probably damaging 1.00
R4705:Bag6 UTSW 17 35142343 missense probably damaging 1.00
R4905:Bag6 UTSW 17 35145186 missense probably damaging 1.00
R5001:Bag6 UTSW 17 35145176 missense probably damaging 1.00
R5168:Bag6 UTSW 17 35144695 missense probably damaging 1.00
R5808:Bag6 UTSW 17 35146322 missense probably damaging 1.00
R6118:Bag6 UTSW 17 35143624 missense probably damaging 0.99
R6212:Bag6 UTSW 17 35140302 missense probably benign 0.17
R6279:Bag6 UTSW 17 35138601 missense probably damaging 1.00
R6300:Bag6 UTSW 17 35138601 missense probably damaging 1.00
R6564:Bag6 UTSW 17 35140371 missense probably damaging 0.98
R6783:Bag6 UTSW 17 35144235 missense possibly damaging 0.94
R6927:Bag6 UTSW 17 35145922 critical splice donor site probably null
R7226:Bag6 UTSW 17 35142945 missense not run
X0025:Bag6 UTSW 17 35146077 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGACTCTCCTGGCACTCTGGATTAG -3'
(R):5'- TTGAGCCCTTCCCACATAGCACTG -3'

Sequencing Primer
(F):5'- GCACTCTGGATTAGGCTCTTG -3'
(R):5'- CCACATAGCACTGGCCTTC -3'
Posted On2014-12-05