Incidental Mutation 'R1630:9930012K11Rik'
ID254724
Institutional Source Beutler Lab
Gene Symbol 9930012K11Rik
Ensembl Gene ENSMUSG00000044551
Gene NameRIKEN cDNA 9930012K11 gene
Synonyms
MMRRC Submission 039667-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R1630 (G1)
Quality Score61
Status Validated
Chromosome14
Chromosomal Location70154405-70159502 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 70157180 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 175 (E175G)
Ref Sequence ENSEMBL: ENSMUSP00000122309 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035612] [ENSMUST00000058240] [ENSMUST00000129767] [ENSMUST00000153871]
Predicted Effect probably benign
Transcript: ENSMUST00000035612
SMART Domains Protein: ENSMUSP00000036924
Gene: ENSMUSG00000033712

DomainStartEndE-ValueType
low complexity region 23 37 N/A INTRINSIC
Pfam:S1-like 55 112 1.3e-29 PFAM
DBC1 339 462 8.48e-73 SMART
low complexity region 496 507 N/A INTRINSIC
low complexity region 534 545 N/A INTRINSIC
low complexity region 563 601 N/A INTRINSIC
low complexity region 627 640 N/A INTRINSIC
low complexity region 647 660 N/A INTRINSIC
SCOP:d2mysb_ 703 747 2e-3 SMART
Blast:HDc 704 758 7e-7 BLAST
coiled coil region 828 898 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000058240
AA Change: E175G

PolyPhen 2 Score 0.165 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000061834
Gene: ENSMUSG00000044551
AA Change: E175G

DomainStartEndE-ValueType
Pfam:DUF4657 78 366 1e-142 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140152
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140314
Predicted Effect probably benign
Transcript: ENSMUST00000153871
AA Change: E175G

PolyPhen 2 Score 0.165 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000122309
Gene: ENSMUSG00000044551
AA Change: E175G

DomainStartEndE-ValueType
Pfam:DUF4657 78 365 1.4e-132 PFAM
Meta Mutation Damage Score 0.1252 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.6%
  • 20x: 90.1%
Validation Efficiency 100% (67/67)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931429P17Rik C A 13: 47,960,725 noncoding transcript Het
A630091E08Rik A G 7: 98,543,607 noncoding transcript Het
Atm A T 9: 53,479,673 L1867Q probably damaging Het
Atp5a1 A G 18: 77,777,567 D63G possibly damaging Het
Baz2b A T 2: 60,006,130 S20T unknown Het
C1qtnf7 G A 5: 43,609,161 C34Y possibly damaging Het
Cactin A G 10: 81,323,725 T353A probably benign Het
Cdyl A G 13: 35,683,803 K21E possibly damaging Het
Crispld1 A G 1: 17,728,798 T48A probably benign Het
Csmd3 T A 15: 47,838,522 T1722S possibly damaging Het
Dapk1 A T 13: 60,729,531 E528V probably damaging Het
Dennd4a A G 9: 64,871,882 D549G probably benign Het
Dnajc5b C A 3: 19,574,741 N66K probably damaging Het
Dusp16 G T 6: 134,720,561 R250S probably damaging Het
F10 A G 8: 13,055,551 N384S probably benign Het
Gabrr2 A G 4: 33,085,647 S331G probably damaging Het
Gm12185 A C 11: 48,907,890 I592S probably benign Het
Gm9755 T C 8: 67,514,660 noncoding transcript Het
Hspg2 T C 4: 137,518,435 L913P probably damaging Het
Ifna1 T A 4: 88,850,329 S81R probably benign Het
Iqgap2 T C 13: 95,689,785 K510E probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lhx6 A G 2: 36,102,901 Y140H probably damaging Het
Lix1 A G 17: 17,457,158 H205R probably damaging Het
Masp2 A T 4: 148,614,033 T524S probably benign Het
Mndal A C 1: 173,874,392 F115V possibly damaging Het
Morc3 C A 16: 93,866,533 N541K probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myocd A G 11: 65,196,394 S236P probably damaging Het
Nes T A 3: 87,977,677 V1037E probably benign Het
Nfkbil1 A G 17: 35,221,164 W178R probably damaging Het
Nobox A T 6: 43,307,212 C8* probably null Het
Nwd1 A G 8: 72,667,029 T348A possibly damaging Het
Olfr1048 A G 2: 86,236,086 S243P probably damaging Het
Olfr1350 T C 7: 6,570,674 S228P probably damaging Het
Olfr382 T C 11: 73,516,720 T160A probably damaging Het
Osbp2 T C 11: 3,717,167 T448A probably benign Het
Plrg1 A G 3: 83,058,763 D75G probably benign Het
Ppp1r8 T C 4: 132,829,437 E213G probably benign Het
Rad54l2 A G 9: 106,703,629 F898L possibly damaging Het
Rapgef6 TG TGG 11: 54,546,397 probably null Het
Rasl10a G C 11: 5,059,542 R110P probably damaging Het
Rttn T C 18: 89,042,954 I1082T probably benign Het
Sema6d A G 2: 124,664,345 D734G possibly damaging Het
Sgce C T 6: 4,719,476 V44M probably damaging Het
Sgo2b A G 8: 63,927,797 V667A possibly damaging Het
Shcbp1 A T 8: 4,748,763 C118* probably null Het
Slain2 C T 5: 72,976,004 P563S probably damaging Het
Slco1b2 A T 6: 141,656,821 I167F probably damaging Het
Speg T C 1: 75,422,977 L2356P probably damaging Het
Sptbn4 A G 7: 27,418,739 V305A probably benign Het
Sspo G A 6: 48,457,724 R1050H probably benign Het
Tmem106b A G 6: 13,081,541 N149S probably benign Het
Tmem200a T C 10: 25,992,914 T486A probably damaging Het
Tmem212 T A 3: 27,885,101 T79S possibly damaging Het
Ttll11 A G 2: 35,889,325 V471A probably damaging Het
Vill A G 9: 119,070,701 N318D probably benign Het
Vmn2r102 A G 17: 19,678,770 D458G possibly damaging Het
Zfp472 T A 17: 32,977,978 C342* probably null Het
Zfp963 A T 8: 69,744,187 probably benign Het
Other mutations in 9930012K11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02673:9930012K11Rik APN 14 70157607 missense probably benign 0.21
IGL03226:9930012K11Rik APN 14 70157609 missense probably damaging 0.97
R0125:9930012K11Rik UTSW 14 70156647 splice site probably benign
R0544:9930012K11Rik UTSW 14 70157314 missense probably benign 0.00
R4546:9930012K11Rik UTSW 14 70156478 missense probably benign 0.22
R4822:9930012K11Rik UTSW 14 70156458 missense probably benign 0.12
R4846:9930012K11Rik UTSW 14 70155943 missense probably damaging 1.00
R5211:9930012K11Rik UTSW 14 70156784 missense probably benign 0.00
R6860:9930012K11Rik UTSW 14 70157622 missense possibly damaging 0.74
X0064:9930012K11Rik UTSW 14 70156772 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATACTGCTGGGTGCGAAGTGAGAC -3'
(R):5'- AGCTCCTTGGCTACCTTATCAGGAC -3'

Sequencing Primer
(F):5'- TGAGACAGAAAGCAATGACACAAC -3'
(R):5'- AAGATTCTCTGAACCTTGAGCC -3'
Posted On2014-12-23